Trifolium monanthum

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records519

Data sources10

Biological traits13

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Trifolium monanthum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility519 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF519 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trifolium monanthum is a species of clover known by the common name mountain carpet clover. It is native to eastern California and western Nevada in the Sierra Nevada, and in Southern California in the eastern Transverse Ranges, and the San Jacinto Mountains. It occurs at elevations above 1500 m in coniferous forests, woodlands, and meadows.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed mass1.14 mg

Seed mass max1.14 mg

Seed mass min1.14 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium monanthum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences9

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ624438.1 ↗728 bpUSA · 2001

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACACGTGAATCAGTTTGAATACATAAGGTTGG …

Trifolium monanthum bio-material R. Morgan personal collection P5 from USA small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trifolium monanthum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · book-ipcn65 · CCDB · book-ipcn67-71

CCDB · book-ipcn65 — Mosquin & G. 1965

CCDB · book-ipcn67-71 — GILLETT, J.M., & T. MOSQUIN. 1967. In IOPB chromosome number reports x. Taxon 16: 146-157.

n 81×CCDB · book-ipcn65

CCDB · book-ipcn65 — Mosquin & G. 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.992 ↗

08Occurrence & distribution

Record type519 records

Wild obs. + sensor326

Museum / vouchered193

Origin

Native21

Range

Area of Occupancy AOO1 372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 197≤1 km 28≤10 km 12>10 km 6

243 georeferenced · 83 without coordinates

Open the mapobservation + sensor326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 4≤1 km 71≤10 km 26

101 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence193

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	34
Santa Barbara, US	26
Claremont, US	22
Bronx, US	20
Riverside, US	15
Angwin, US	11
US	7
LDlocation not on record	5
Flagstaff, US	4
San Luis Obispo, US	4
San Francisco, US	4
San Jose, US	3
Logan, US	3
Long Beach, US	3
Arcata, US	2
Los Angeles, US	2
San Diego, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
Truckee, US	2
Turlock, US	2
Pocatello, US	1
Henderson, US	1
EL PASO, US	1
Provo, US	1
Columbia, US	1
Phoenix, US	1
CASlocation not on record	1
INFlocation not on record	1
New Haven, US	1
Santa Cruz, US	1
Istituto Agrario Castelnuovolocation not on record	1

31 institutions · 184 of 193 vouchered records shown · 9 without an institution code

09Environmental DNA1 detections

Where the DNA of Trifolium monanthum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)