Trifolium medium
speciesAt a glance
Occurrence records257 588
Data sources12
Biological traits50
DNA specimens46
eDNA detections644
Sources12 archives
Databases and archives Trifolium medium's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility257 588 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI644 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics46 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources50 traits
Chemical compositionLOTUS · NPASS36 compounds
Occurrence & distributionGBIF257 588 records
Environmental DNA2 datasets · 9 countries644 detections
DNA & barcodingBOLD · NCBI46 specimens
Genome at a glanceCCDB · GoaT · NCBI4.5 Gbp
01Narrative
Trifolium medium, le Trèfle flexueux, Trèfle intermédiaire ou Trèfle moyen est une espèce de plantes à fleurs du genre Trifolium et de la famille des Fabaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology15
Fruit length2 mm
Leaf length max100 mm
Leaf mass65.74 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 1 437 mm² · GIFT: 1 437 mm²
Plant height0.4 m
⚠ sources differ — GIFT: 0.4 m · LEDA: 0.4 m · TRY: 0.25 m
Plant height generative0.25 m
Plant height max0.5 m
Plant height min0.2 m
Seed length1.84 mm
Seed mass2.01 mg
⚠ sources differ — TRY: 2.01 mg · LEDA: 2.13 mg · GIFT: 1.95 mg
Seed mass max2.34 mg
Seed mass min1.28 mg
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years10 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number30
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 600 m
Elevation min1 450 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTLowland
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf c449 mg/g
Leaf dry-matter content (LDMC)263 mg/g
Leaf n34 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)14.5 mm²/mg
⚠ sources differ — TRY: 14.5 mm²/mg · LEDA: 20.61 mm²/mg · GIFT: 20.61 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition36 compounds
Compounds documented for Trifolium medium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Pterocarpan5
Isoflavones5
Germacrane sesquiterpenoids5
Menthane monoterpenoids5
Merohemiterpenoids4
Documented compounds36 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| (-)-Caryophyllene | present | NPASS | |
| (-)-Maackiain | present | LOTUS | |
| (1S,2E,10R)-3,7,11,11-tetramethylbicyclo[8.1.0]undeca-2,6-diene | present | NPASS | |
| (4R,5S)-4,5-dihydroxy-5-methyl-2-propan-2-ylcyclohex-2-en-1-one | present | NPASS | |
| 1-(2,2-Dimethylchromen-6-yl)-2-hydroxyethanone | present | NPASS | |
| 2-Isopropyl-5-methylphenol | present | NPASS | |
| 2-Isopropyl-p-cresol | present | NPASS | |
| 4-Coumaric acid | present | LOTUS | |
| 4-Methyl-1-(2-methylpropoxy)-2-propan-2-ylbenzene | present | NPASS |
05DNA & barcoding46 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium medium has left across the world's sequence archives.
At a glance
DNA specimens46
Marker genes6
GenBank sequences10
eDNA detections644
Countries9
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATC …
Trifolium medium voucher HAVR-2017-21 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK8★rbcL★rbcLa★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Trifolium medium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 469 460 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Trifolium medium4.47 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 64 n = 32
Ploidy10× 10× · measured
Chromosome records16–842n range64median64mode84records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6431×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +1
CCDB · slov-fl — Murín A. & Májovský J., 1987: Karyological study of the Slovak flora XIX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 34 [1986]: 3-20.
CCDB · slov-fl — Hrušovská-Osuská Ľ., 1988: Karyological study of some taxa of the flora of the northern part of Považský Inovec. Part I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 35: 69-79.
CCDB · slov-fl — Murín A. & Májovský J., 1983: Karyological study of Slovakian flora IV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 30: 1-16.
CCDB · slov-fl — Májovský J. & Murín A., 1988: Trifolium medium Grufb. in L. ex Huds. wächst nicht in der Slowakei. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 35: 3-20.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · ipcn-api-dl — Hruaovská-Osuská, L. 1988. Karyological study of some taxa of the flora of the northern part of Povăzsk@3y Inovec. Part I. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 35: 69–79.
CCDB · ipcn-api-dl — Májovský, J. & A. Murín. 1988. Trifolium medium Grufb. in L. ex Huds. wächst nicht in der Slowakei. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 35: 3–20.
CCDB · ipcn-api-dl — Murín, A. & J. Májovský. 1987. Karyological study of the Slovak flora XIX. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 34: 3–20.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).
CCDB · book-ipcn72 — KOZUHAROV, S.I., B.A. KUZMANOV, T. MARKOVA. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn72 — KUZMANOV, B.A., & G. STANCEV. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · CromoCat 2015 — Holub, J., Mesícek, J. & Javürková, V. (1972). Annotated chromosome counts of Czechoslovak plants (31-60). Folia Geobot. Phytotax. (Bohem.) 7: 167-202.
CCDB · CromoCat 2015 — Kuzmanov, B. (1978). Citotaxonomicno izsledvane na balgarski bobovi rastcnija. In: Evoljuclja na cvetnite rastenija i florogenez 1: 11-71.
CCDB · CromoCat 2015 — Petrova, A. & S. Kozuharov. (1982). Cytotaxonomic study of genus Trifolium L. in Bulgaria. I. II. Phytology 19: 3-23; 20: 20-41.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Kozuharov, S., Kuzmanov, B. & Markova, T. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVI]. Taxon 21(2/3): 336-337.
CCDB · CromoCat 2015 — Kuzmanov, B. A. & Stancev, G. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVIII]. Taxon 21(5/6): 681.
2n 8021×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2973
CCDB · poland — Pogan E., Czapik R., Jankun A., Kuta E. et al. 1982 a. Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov. Ser. Bot. 24, 91-126.
CCDB · poland — Kazimierski T., Kazimierska E. M. and Strzy?ewska C. 1972. Species crossing in the genus\nTrifolium L. Gen. Pol. 13, 11-32.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK, A. Jankun & E. Kuta. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 113–126.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn75-78 — Nielsen 1975
CCDB · kew — Vižintin L, Javornik B, Bohanec B. 2006. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Science 170: 859-866.
CCDB · CromoCat 2015 — Holub, J., Mesícek, J. & Javürková, V. (1972). Annotated chromosome counts of Czechoslovak plants (31-60). Folia Geobot. Phytotax. (Bohem.) 7: 167-202.
CCDB · CromoCat 2015 — Al-Bermani, A.-K. K. A., Al-Shammary, K. I. A., Gornall, R. J. & Bailey, J. P. (1993). Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169-171.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.
CCDB · iapt — IAPT/IOPB Chromosome Data 34
2n 4819×CCDB · slov-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +2
CCDB · slov-fl — Murín A. & Májovský J., 1987: Karyological study of the Slovak flora XIX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 34 [1986]: 3-20.
CCDB · slov-fl — Uhríková A. & Májovský J., 1983: [Report], pp. 507. - In: Löve Á. (ed.), IOPB Chromosome number reports LXXX, Taxon 32 /3.
CCDB · slov-fl — Činčura F., 1965: Cytotaxonomické vyhodnotenie Trifolium sarosiense Hazsl. - Biologia (Bratislava) 20/4: 300-305.
CCDB · slov-fl — Májovský J. & Murín A., 1988: Trifolium medium Grufb. in L. ex Huds. wächst nicht in der Slowakei. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 35: 3-20.
CCDB · book-ipcn65 — Cincura 1965
CCDB · ipcn-api-dl — Efimov, K. F. 1990. <In> A. Takhtajan (editor), Numeri Chromosomatum Magnoliophytorum Florae URSS, Aceraceae--Menyanthaceae. Nauka, Leninopoli
CCDB · ipcn-api-dl — Uhrikova, A. & J. Majovksy. 1983. In IOPB chromosome number reports LXXX. Taxon 32: 507.
CCDB · ipcn-api-dl — Májovský, J. & A. Murín. 1988. Trifolium medium Grufb. in L. ex Huds. wächst nicht in der Slowakei. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 35: 3–20.
CCDB · ipcn-api-dl — Murín, A. & J. Májovský. 1987. Karyological study of the Slovak flora XIX. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 34: 3–20.
CCDB · ipcn-api-dl — Taylor, N. L., R. F. Quarles & M. K. Anderson. 1980. Methods of overcoming interspecific barriers in Trifolium. Euphytica 29: 441–450.
CCDB · ipcn-api-dl — Yefimov, K. F. 1987. Chromosome numbers in some members of the Fabaceae from central Caucasus. Bot. Zhurn. 72: 845.
CCDB · book-ipcn75-78 — Nielsen 1975
CCDB · CromoCat 2015 — Efimov, K. F. (1990). Numeri Chromosomatum Magnoliophytorum Florae URSS, Aceraceae--Menyanthaceae. A. Takhtajan (editor) Nauka, Leninopoli
CCDB · CromoCat 2015 — Oberprieler, C. & R. Vogt. (1996). Mediterranean chromosome number reports-6. Fl. Medit. 6: 262-266.
2n 844×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · CromoCat 2015 — Muñoz Rodríguez, A. F. (1993a). Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89-118.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 162×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · book-ipcn73-74 — CHEN, C.-C., & P.B. GIBSON. 1971. Karyotypes of fifteen Trifolium species in section Amoria. Crop Sci. 11: 441-445.
CCDB · CromoCat 2015 — Magulaev, A. Y. (1989). The number of middle clover chromosomes in flora of Crimea and Caucasus. Citologija i Genetika 23: 26-29.
2n 792×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Holub, J., Mesícek, J. & Javürková, V. (1972). Annotated chromosome counts of Czechoslovak plants (31-60). Folia Geobot. Phytotax. (Bohem.) 7: 167-202.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 822×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Holub, J., Mesícek, J. & Javürková, V. (1972). Annotated chromosome counts of Czechoslovak plants (31-60). Folia Geobot. Phytotax. (Bohem.) 7: 167-202.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 321×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Magulaev, A. Y. (1989). The number of middle clover chromosomes in flora of Crimea and Caucasus. Citologija i Genetika 23: 26-29.
2n 501×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Magulaev, A. Y. (1989). The number of middle clover chromosomes in flora of Crimea and Caucasus. Citologija i Genetika 23: 26-29.
2n 561×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Magulaev, A. Y. (1989). The number of middle clover chromosomes in flora of Crimea and Caucasus. Citologija i Genetika 23: 26-29.
2n 721×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 761×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
10×1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness7.7% BUSCO
08Occurrence & distribution
Record type257 588 records
Wild obs. + sensor247 471
Museum / vouchered9 645
Cultivated / captive81
Other391
Origin
Native15 216
Introduced24
Range
Area of Occupancy AOO354 564 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy52% within 1 km
≤100 m 67 170≤1 km 39 108≤10 km 96 954>10 km 1 269
204 501 georeferenced · 42 970 without coordinates
Open the mapobservation + sensor247 471
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 877≤1 km 1 575≤10 km 3 353>10 km 885
6 690 georeferenced · 2 955 without coordinates
Open the institutions mapphysical evidence9 645
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy17% within 1 km
≤1 km 4≤10 km 4>10 km 15
23 georeferenced · 58 without coordinates
Open the mapnot free-living81
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions87 of 178 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 677 |
| Helsinki, FI | 645 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 530 |
| BFLlocation not on record | 473 |
| Moscow State Universitylocation not on record | 428 |
| LDlocation not on record | 377 |
| Olocation not on record | 362 |
| BIO-UNIPIlocation not on record | 233 |
| Salzburg, AT | 200 |
| Kuopio, FI | 176 |
| SLU Artdatabankenlocation not on record | 163 |
| Oskarshamn, SE | 138 |
| MeiseBGlocation not on record | 130 |
| Bergen, NO | 127 |
| Oulu, FI | 115 |
| Turku, FI | 106 |
| Trondheim, NO | 94 |
| Adam Mickiewicz University in Poznańlocation not on record | 86 |
| Uniwersytet Warszawskilocation not on record | 83 |
| BRNUlocation not on record | 78 |
| KMNlocation not on record | 75 |
| Tallinn, EE | 70 |
| Jyväskylä, FI | 65 |
| TUR-Alocation not on record | 59 |
| Provincia di Livornolocation not on record | 58 |
| Tartu, EE | 56 |
| Görlitz, DE | 55 |
| Mlocation not on record | 54 |
| South Kensington, GB | 48 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 41 |
| Karlsruhe, DE | 40 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 39 |
| Museo Entomologico de Leonlocation not on record | 36 |
| Uppsala, SE | 32 |
| Bern, CH | 32 |
| Dresden, DE | 31 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 31 |
| Berlin, DE | 30 |
| València, ES | 27 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 26 |
| Wlocation not on record | 25 |
| TROMlocation not on record | 23 |
| Brussel, BE | 23 |
| MAlocation not on record | 22 |
| BDBClocation not on record | 21 |
| GJOlocation not on record | 21 |
| Porvoo, FI | 20 |
| Philadelphia, US | 19 |
| Entomological Society of Latvialocation not on record | 19 |
| DBF-NHMDlocation not on record | 19 |
| Zürich, CH | 19 |
| Vitoria, ES | 17 |
| Voronezh State Universitylocation not on record | 16 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 15 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| SVK001location not on record | 11 |
| Frankfurt am Main | 11 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 11 |
| BClocation not on record | 11 |
| GBR016location not on record | 10 |
| UGentlocation not on record | 10 |
| San Sebastián, ES | 9 |
| Tula State Universitylocation not on record | 9 |
| SZUlocation not on record | 8 |
| Bronx, US | 8 |
| Frauenfeld, CH | 8 |
| Glarus, CH | 8 |
| Zürich, CH | 7 |
| Québec, CA | 7 |
| Podgorica, ME | 7 |
| Salamanca, ES | 7 |
| POL003location not on record | 7 |
| SWE054location not on record | 7 |
| Stockholm, SE | 7 |
| SWlocation not on record | 7 |
| Barcelona, ES | 6 |
| Naturalis Biodiversity Centerlocation not on record | 6 |
| Saint John, CA | 6 |
| CJBGlocation not on record | 6 |
| Pamplona, ES | 6 |
| College of the Atlantic, Museumlocation not on record | 6 |
| Nijmegen, NL | 6 |
| Christchurch, NZ | 5 |
| Sion, CH | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| LfUlocation not on record | 5 |
| Porrentruy, CH | 5 |
| SVN019location not on record | 5 |
| NMBU:MINAlocation not on record | 5 |
| Bourges, FR | 5 |
| PrivatHerblocation not on record | 5 |
| Rovaniemi, FI | 5 |
| Forssa, FI | 5 |
| Kandalaksha State Nature Reservelocation not on record | 5 |
| Gijón, ES | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Edinburgh, GB | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| GZUlocation not on record | 3 |
| nbflocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Alicante, ES | 3 |
| Durham, US | 3 |
| 3 | |
| College Park, US | 3 |
| BSBIlocation not on record | 3 |
| Burlington, US | 3 |
| H-Schuhwlocation not on record | 3 |
| Badajoz, ES | 3 |
| Fulda, DE | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Madrid, ES | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Pretoria, ZA | 2 |
| Moscow, US | 2 |
| Palmerston North, NZ | 2 |
| Göteborg, SE | 2 |
| Wellington, NZ | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| CJBNlocation not on record | 2 |
| Lausanne, CH | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| FLADlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Boumlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| Taipei, TW | 1 |
| LUXEMBOURG, LU | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Rotorua, NZ | 1 |
| Auckland, NZ | 1 |
| Dhaka, BD | 1 |
| Umeå Universitylocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| ISAlocation not on record | 1 |
| AZE006location not on record | 1 |
| Xiamen, CN | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Pamplona, ES | 1 |
| Coimbra, PT | 1 |
| Davenport, US | 1 |
| München, DE | 1 |
| Tsukuba, JP | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Salvador, BR | 1 |
| Madrid, ES | 1 |
| EL PASO, US | 1 |
| Toronto, CA | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Montréal, CA | 1 |
| Kingston, US | 1 |
| Dekalb, US | 1 |
| Bloomington, US | 1 |
| Hobart, AU | 1 |
| ROM007location not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| H-AkrKGlocation not on record | 1 |
| SNSNMClocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Kew, GB | 1 |
| Boise, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Canberra, AU | 1 |
| Santiago de Compostela, ES | 1 |
| ULBF-AGRlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
178 institutions · 8 844 of 9 645 vouchered records shown · 564 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA644 detections
Where the DNA of Trifolium medium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found644
Studies independent surveys2
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 644 detections have coordinates
Open the map9 countries0
IGER glasshouseSur les platieres calcaires de la riviere Re…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.6 °C 12.5–17.6
Seasonal swing summer↔winter22.7 °C
Max temp (day)21.4 °C 16.2–21.4
Min temp (night)13.5 °C 9.50–13.5
Precipitation74.3 mm/mo 56.8–75.7
Air humidity60.4 % 60.4–62.4
Moisture balance-54.1 mm/mo -55.1–-7.10
Vapour deficit802 Pa 546–802
Wind speed3.50 m/s 3.50–4.20
Cloud cover38.4 % 38.4–43.3
CHELSA 1981–2010, ~9 km grid, at location & month of 609 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.