Trifolium macrocephalum

(Pursh) Poir. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records1 987

Data sources10

Biological traits91

DNA specimens1

eDNA detections41

Sources10 archives

Databases and archives Trifolium macrocephalum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 987 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources91 traits

Occurrence & distributionGBIF1 987 records

Environmental DNA2 datasets · 1 countries41 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Trifolium macrocephalum là một loài thực vật có hoa trong họ Đậu. Loài này được (Pursh) Poir. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.61 m

Seed mass6.53 mg

⚠ sources differ — TRY: 6.53 mg · GIFT: 5.05 mg

Seed mass max7.3 mg

Seed mass min6.84 mg

Life cycle & reproduction23

Bloom periodMid Spring

Coppice potentialNo

Flower colourpurple

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endSummer

Growth rate USDARapid

Life formperennial

Life spanperennial

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateModerate

Seedling vigorMedium

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

Growth form USDASingle Crown

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min6 in

Shape and orientationDecumbent

Small grainNo

Woodinessnon-woody

Physiology & chemistry20

Anaerobic toleranceHigh

C:N ratioLow

Caco3 toleranceHigh

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min80 days

Moisture useLow

Nitrogen fixation levelMedium

Photosynthetic pathwayC3

Precipitation max20 in

Precipitation min10 in

Protein potentialMedium

Salinity toleranceMedium

Shade toleranceMedium

Soil pH max7.1 pH

Soil pH min6.2 pH

Temperature min52 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productYes

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalMedium

Palatable graze animalHigh

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound150 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium macrocephalum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections41

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX254372.1 ↗640 bpUSA · 1993

ACGT

CCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACACGTGAATCAGTTTGAACACATAGGGTTGGTTTGAGGTGTTCAACACC …

Trifolium macrocephalum 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trifolium macrocephalum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Reveal, J. L. & R. Spellenberg. 1976. Miscellaneous chromosome counts of Western American plants - III. Rhodora 78: 37–52.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 987 records

Wild obs. + sensor1 431

Museum / vouchered552

Other4

Origin

Native21

Range

Area of Occupancy AOO3 924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 889≤1 km 118≤10 km 69>10 km 56

1 132 georeferenced · 299 without coordinates

Open the mapobservation + sensor1 431

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 29≤1 km 160≤10 km 148>10 km 15

352 georeferenced · 200 without coordinates

Open the institutions mapphysical evidence552

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions35 of 50 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	100
Corvallis, US	85
WTUlocation not on record	79
Moscow, US	46
Bronx, US	29
Caldwell, US	20
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	16
CASlocation not on record	16
Boise, US	15
US	15
Pocatello, US	8
Bend, US	7
Henderson, US	6
Provo, US	6
Arcata, US	6
Claremont, US	6
Cheney, US	5
Ashland, US	5
Canadian Department of Agriculturelocation not on record	5
LDlocation not on record	4
Angwin, US	4
Portland, US	4
University of Stellenboschlocation not on record	4
Portland, US	4
Davis, US	4
ASUlocation not on record	3
Riverside, US	3
Tacoma, US	2
Moscow State Universitylocation not on record	2
KNFHClocation not on record	2
San Luis Obispo, US	2
IDElocation not on record	2
Santa Barbara, US	2
Flagstaff, US	2
Logan, US	2
San Diego, US	1
Kew, GB	1
Weber State Universitylocation not on record	1
Walla Walla, US	1
Tampa, US	1
VALElocation not on record	1
San Jose, US	1
Orem, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
Chongqing Museumlocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Beijing, CN	1
Bangkok, TH	1
Bloomington, US	1
Santa Cruz, US	1

50 institutions · 536 of 552 vouchered records shown · 16 without an institution code

09Environmental DNA41 detections

Where the DNA of Trifolium macrocephalum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 17.5–17.5

Seasonal swing summer↔winter24.4 °C

Max temp (day)24.2 °C

Min temp (night)10.7 °C

Precipitation122 mm/mo

Air humidity46.0 %

Moisture balance-45.7 mm/mo

Vapour deficit1,079 Pa

Wind speed1.80 m/s

Cloud cover19.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trifolium macrocephalum

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction23

Diet & foraging1

Habitat & environment24

Physiology & chemistry20

Uses & economy15

Other traits4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 987 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions35 of 50 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 987 records