Trifolium macraei

Hook. & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records463

Data sources10

Biological traits16

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Trifolium macraei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility463 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF463 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trifolium macraei is a species of clover known by the common names Chilean clover, double-head clover, and MacRae's clover. It has a disjunct distribution, occurring on the coastline of Oregon and California in the United States, as well as in South America.Knapp, E. E. and P. G. Connors. (1999). Genetic consequences of a single-founder population bottleneck in Trifolium amoenum (Fabaceae). American Journal of Botany 86 124-30. It grows in coastal habitat, such as sand dunes, and disturbed areas. It is an annual herb taking a decumbent or erect form. The leaves are made up of oval leaflets 1 to 2 centimeters in length. The inflorescence is usually made up of two oval or rounded heads of flowers each measuring up to 1.5 centimeters wide. Each flower has a calyx of sepals which taper into densely hairy bristles. The flower corolla is purple or bicolored with white or pink.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.52 mg

Seed mass max1.52 mg

Seed mass min1.52 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max600 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium macraei has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ624412.1 ↗732 bpUSA · 1998

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACATGTGAATCAGTTTCAACACATAAGGTTGG …

Trifolium macraei bio-material R. Morgan personal collection N57 from USA small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★ITS10

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trifolium macraei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GILLETT, J.M., & T. MOSQUIN. 1967. In IOPB chromosome number reports x. Taxon 16: 146-157.

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GILLETT, J.M., & T. MOSQUIN. 1967. In IOPB chromosome number reports x. Taxon 16: 146-157.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.992 ↗

07Deep time~15.7 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin15.7 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type463 records

Wild obs. + sensor197

Museum / vouchered265

Other1

Range

Area of Occupancy AOO1 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 108≤1 km 13>10 km 12

133 georeferenced · 64 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 12≤1 km 113≤10 km 53>10 km 4

182 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence265

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	57
Santa Cruz, US	22
Claremont, US	19
San Luis Obispo, US	19
LDlocation not on record	17
Arcata, US	12
Pullman, US	10
Corvallis, US	10
US	9
San Diego, US	9
Davis, US	9
Riverside, US	6
Bronx, US	4
San Francisco, US	3
Portland, US	3
Bloomington, US	3
CASlocation not on record	2
Istituto Agrario Castelnuovolocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Tacoma, US	1
WTUlocation not on record	1
San Jose, US	1
Catalina Island Conservancylocation not on record	1
Mississippi State, US	1
Angwin, US	1
Wuzhou, CN	1
Canadian Department of Agriculturelocation not on record	1

27 institutions · 226 of 265 vouchered records shown · 39 without an institution code

09Environmental DNA1 detections

Where the DNA of Trifolium macraei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)