Trifolium latinum

Sebast. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records27

Data sources10

Biological traits6

DNA specimens3

eDNA detections1

Sources10 archives

Databases and archives Trifolium latinum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trifolium latinum ist eine Pflanzenart aus der Gattung Klee (Trifolium). Er wird in der Gattung in die Sektion Trifolium, Untersektion Echinata gestellt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formannual

Raunkiær life formtherophyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formannual forb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium latinum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences8

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMW684039.1 ↗209 bpUSA

ACGT

CGAAGCCTCTTGCCAATTTCCTATTGGTTGGTATTGTGCAGGATGATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTTGGTTGAAAA …

Trifolium latinum clone TR-19 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trifolium latinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982a. Cytotaxonomic study of Trifolium L.: Bulgaria II. Fitologija 20: 20–40. (In Bulgarian).

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — PUTHEVSKY, E., & J. KATZNELSON. 1970. Chromosome number and genetic system in several Trifolium species related to T. alexandrinum. Chromosoma CBerl.J 30: 476-482. -

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.988 ↗

08Occurrence & distribution

Record type27 records

Museum / vouchered27

Range

Area of Occupancy AOO96 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence27

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	17
LDlocation not on record	9
Canadian Department of Agriculturelocation not on record	1

3 institutions · 27 of 27 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Trifolium latinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)