Trifolium lappaceum
speciesAt a glance
Occurrence records6 253
Data sources14
Biological traits38
DNA specimens5
eDNA detections3
Sources14 archives
Databases and archives Trifolium lappaceum's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 253 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics5 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources38 traits
Chemical compositionLOTUS3 compounds
Occurrence & distributionGBIF6 253 records
Environmental DNA1 datasets · 1 countries3 detections
DNA & barcodingBOLD · NCBI5 specimens
Genome at a glanceCCDB · GoaT342 Mbp
01Narrative
Trifolium lappaceum, the burdock clover, is a species of annual herb in the family Fabaceae. They have a self-supporting growth form and compound, broad leaves.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYAusTraitsLEDAGIFTWCVP
Size & morphology11
Fruit length2 mm
Leaf length12.5 mm
Leaf length max23 mm
Leaf width max13 mm
Plant height0.35 m
Plant height max0.6 m
Plant height min0.05 m
Seed length1.5 mm
Seed mass0.878 mg
Seed mass max1.17 mg
Seed mass min0.64 mg
Life cycle & reproduction11
Dispersal typeanimal
Flower colourpink
Flowering endJun
Flowering startMar
Life formannual
Life spanannual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit typelegume
Growth formherb
Habitat GIFTmountains
Leaf compoundnesscompound
Leaf formobovate
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC3
Other traits2
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition3 compounds
Compounds documented for Trifolium lappaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Pterocarpan3
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| Medicarpin | present | LOTUS |
05DNA & barcoding5 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium lappaceum has left across the world's sequence archives.
At a glance
DNA specimens5
Marker genes3
GenBank sequences9
eDNA detections3
Countries3
The DNA barcodea real sequence read deposited for this species
TCGATGCCTTACATGCAGACCAACTCGTGAATCAGTTTGAACACATAGGGCTGGTTTGAGGTGTTCAACACCTTGGCTTGCCTCTGGTTC …
Trifolium lappaceum clone TR-18 internal transcribed spacer 1, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★ITS7
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Trifolium lappaceum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size342 300 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium lappaceum0.34 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records14–162n range16median16mode50records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1649×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — DE LEONARDIS W., PAVONE P., TERRASI M.C., ZIZZA A. - 1983 (1981). Numeri cromosomici per la flora italiana:814-830.. Inform. Bot. Ital. , 13(2-3): 158-167.
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. III Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Bol. Soc. Brot. ser. 244: 13-26(1970).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VII Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Gent. Ibr.24: 305-324(1972).
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2984
CCDB · mediterranean
CCDB · ipcn-api-dl — De Leonardis, W., P. Pavone, M. C. Terrasi & A. Zizza. 1981. Numeri cromosomici per la Flora Italiana: 814-830. Inform. Bot. Ital. 13: 158–167.
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · ipcn-api-dl — ANGULO, M. D. & M. C. Figueras. 1979. Numeros cromosomicos y sacos polinicos en especies del genero Trifolium. Genét. Ibér. 30–31: 129–160.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · ipcn-api-dl — Natarajan, G. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · book-ipcn67-71 — ANGULO, M.D., A.M. SANCHEZ DE RIVERA, & F. GONZALEZ BERNALDEZ. 1970. Estudios cromosomicos en el genero Trifolium. III. Bol. Soc. Bort. 44Cser 2): 13-26.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn75-78 — Kozuharov et al. 1975
CCDB · book-ipcn75-78 — Natarajan 1978
CCDB · book-ipcn75-78 — Natarajan 1977
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I
CCDB · book-atlas-flowering-plants — Karpechenko 1925
CCDB · kew — Vižintin L, Javornik B, Bohanec B. 2006. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Science 170: 859-866.
CCDB · CromoCat 2015 — Angulo, M. D. & Figueras, M. C. (1979). Números cromosómicos y sacos polínicos en especies del género Trifolium. Genét. Ibér. 31: 129-160.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1970). Estudios cromosómicos en el género Trifolium. III. Bol. Soc. Brot. 44: 13-26.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1972b). Estudios cromosómicos en el género Trifolium. VII. Genét. Ibér. 24: 305-324.
CCDB · CromoCat 2015 — Bleier, H. (1925a). Chromosomenstudien bei der gattung Trifolium. Jahrb. Wiss. Bot. 64: 604-636.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1975). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Bol. Soc. Brot. 49: 173-196.
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
CCDB · CromoCat 2015 — Karpechenko, G. D. (1925). Karyologische studien über dir gattung Trifolium L. Bull. Appl. Bot., Genet. & Plant Breeding 14: 271-279.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1975b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVII]. Taxon 24(1): 145-146.
+9 more references
2n 141×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Zohary, M. (1971). A revision of the species of Trifolium sect. Trifolium (Leguminosae). I. Introduction. Candollea 26: 297-308.
n 83×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · CromoCat 2015 — Runemark, H. (2006). Reports (1473-1571). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 408-425
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.988 ↗
08Occurrence & distribution
Record type6 253 records
Wild obs. + sensor4 747
Museum / vouchered1 195
Cultivated / captive82
Other229
Origin
Native126
Range
Area of Occupancy AOO12 576 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy39% within 1 km
≤100 m 843≤1 km 591≤10 km 2 125>10 km 152
3 711 georeferenced · 1 036 without coordinates
Open the mapobservation + sensor4 747
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 39≤1 km 106≤10 km 121>10 km 9
275 georeferenced · 920 without coordinates
Open the institutions mapphysical evidence1 195
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 25>10 km 15
40 georeferenced · 42 without coordinates
Open the mapnot free-living82
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions53 of 96 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 198 |
| BIO-UNIPIlocation not on record | 178 |
| Berlin, DE | 135 |
| ISAlocation not on record | 39 |
| MAlocation not on record | 37 |
| BDBClocation not on record | 36 |
| Museo Entomologico de Leonlocation not on record | 34 |
| Kew, GB | 31 |
| València, ES | 29 |
| Moscow State Universitylocation not on record | 29 |
| BClocation not on record | 26 |
| Badajoz, ES | 24 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 22 |
| BRNUlocation not on record | 17 |
| Wlocation not on record | 16 |
| Tuscaloosa, US | 14 |
| CICYTEXlocation not on record | 12 |
| Adelaide, AU | 11 |
| CJBGlocation not on record | 11 |
| Barcelona, ES | 10 |
| Minia, EG | 10 |
| South Kensington, GB | 10 |
| Entomological Society of Latvialocation not on record | 9 |
| GJOlocation not on record | 9 |
| Riverside, US | 9 |
| Phyletisches Museum Jenalocation not on record | 9 |
| Jackson, US | 9 |
| Sevilla, ES | 9 |
| AZE015location not on record | 8 |
| Córdoba, ES | 8 |
| College of the Atlantic, Museumlocation not on record | 8 |
| Fort Worth, US | 6 |
| Paris, FR | 5 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Granada, ES | 5 |
| Frankfurt am Main | 5 |
| Salamanca, ES | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| ESP010location not on record | 4 |
| Bern, CH | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Vitoria, ES | 4 |
| Austin, US | 4 |
| Philadelphia, US | 4 |
| Rishon Le Zion, IL | 4 |
| Boise, US | 4 |
| Little Rock, US | 3 |
| US | 3 |
| PRT004location not on record | 3 |
| Jaén, ES | 3 |
| Alicante, ES | 3 |
| Brussel, BE | 3 |
| EL PASO, US | 3 |
| JBSlocation not on record | 3 |
| GZUlocation not on record | 3 |
| Oskarshamn, SE | 2 |
| ASUlocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Santiago de Compostela, ES | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Knoxville, US | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Mlocation not on record | 2 |
| Bronx, US | 2 |
| Görlitz, DE | 2 |
| BSBIlocation not on record | 2 |
| San Sebastián, ES | 2 |
| Hobart, AU | 2 |
| GAlocation not on record | 2 |
| Madrid, ES | 2 |
| Mississippi State, US | 2 |
| Göteborg, SE | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| Durham, US | 1 |
| Bourges, FR | 1 |
| Pamplona, ES | 1 |
| Bloomington, US | 1 |
| Canberra, AU | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| AUAlocation not on record | 1 |
| Porto Alegre, BR | 1 |
| BG-NMNHSlocation not on record | 1 |
| Coimbra, PT | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| UIBlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Helsinki, FI | 1 |
| Uppsala, SE | 1 |
| IPE-CSIClocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| San Angelo, US | 1 |
| Wuzhou, CN | 1 |
| Bangkok, TH | 1 |
96 institutions · 1 162 of 1 195 vouchered records shown · 32 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA3 detections
Where the DNA of Trifolium lappaceum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 15.4–15.4
Seasonal swing summer↔winter15.3 °C
Max temp (day)20.5 °C
Min temp (night)10.4 °C
Precipitation70.4 mm/mo
Air humidity57.7 %
Moisture balance-28.0 mm/mo
Vapour deficit804 Pa
Wind speed2.90 m/s
Cloud cover41.2 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.