Trifolium incarnatum
speciesAt a glance
Occurrence records71 751
Data sources16
Biological traits141
DNA specimens19
eDNA detections11
Sources16 archives
Databases and archives Trifolium incarnatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility71 751 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics19 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources141 traits
Chemical compositionLOTUS · NPASS31 compounds
Occurrence & distributionGBIF71 751 records
Environmental DNA1 datasets · 4 countries11 detections
DNA & barcodingBOLD · NCBI19 specimens
Genome at a glanceCCDB · GIFT · GoaT766 Mbp
01Narrative
Le Trèfle incarnat ou Trèfle du Roussillon ou farouch est une espèce de plantes à fleurs du genre Trifolium et de la famille des Fabacées. C'est une plante herbacée originaire de la Méditerranée. Fréquemment utilisé comme fourrage et engrais vert, il peut former d'importantes colonies. Ses fleurs sont rouge sang le plus souvent, parfois roses ou blanc jaunâtre. On en connaît deux sous-espèces : - subsp. incarnatum, ici décrite ; - subsp. molinerii Ces. 1844.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology25
Fruit length3 mm
⚠ sources differ — AusTraits: 3 mm · GIFT: 4 mm
Leaf length15 mm
Leaf length max70 mm
Leaf length min10 mm
Leaf mass67.03 mg
Leaf size1 018 mm²
⚠ sources differ — TRY: 1 018 mm² · LEDA: 1 842 mm² · GIFT: 1 842 mm²
Leaf width12.5 mm
Leaf width max15 mm
Leaf width min10 mm
Plant height0.409 m
⚠ sources differ — GIFT: 0.409 m · AusTraits: 0.35 m · LEDA: 0.3 m · USDA: 0.457 m · TRY: 0.195 m
Plant height generative0.32 m
Plant height max0.6 m
Plant height min0.1 m
Seed length2.33 mm
Seed length max2.5 mm
Seed length min2 mm
Seed mass3.29 mg
⚠ sources differ — TRY: 3.29 mg · LEDA: 2.81 mg · GIFT: 2.89 mg
Seed mass max4.32 mg
Seed mass min0.363 mg
Seed volume2.9 mm³
Seed volume max2.9 mm³
Seed volume min2.9 mm³
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction36
After harvest regrowth rateSlow
Bloom periodEarly Spring
Coppice potentialNo
Deciduousnessalways overwintering green
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flower colourred
Flower conspicuousYes
Flowering endJul
Flowering startMay
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number1 029
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment32
Active growth periodFall, Winter and Spring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatLow
Climatetemperate
Climberself-supporting
Elevation max1 550 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
Growth form USDASingle Crown
Habitat GIFTforest, meadows, mountains
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesscompound
Leaf retentionNo
Leaf shapeobovate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceLow
C:N ratioLow
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementHigh
Fire resistantNo
Fire toleranceNone
Frost free days min180 days
Leaf dry-matter content (LDMC)187 mg/g
Leaf n42.19 mg/g
Moisture useMedium
Nitrogen fixation levelMedium
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max65 in
Precipitation min32 in
Protein potentialHigh
Salinity toleranceNone
Seed longevity index1
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min5.5 pH
Specific leaf area (SLA)29.5 mm²/mg
⚠ sources differ — TRY: 29.5 mm²/mg · LEDA: 26.98 mm²/mg · GIFT: 26.99 mm²/mg
Temperature min12 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound149 760 per lb
ToxicityNone
Veneer productNo
Other traits6
Diaspore typefruit with appendage
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Seeds per fruit101-1000
03Chemical composition31 compounds
Compounds documented for Trifolium incarnatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Chalcones6
Isoflavones6
Flavones4
Pterocarpan3
Cyclitols2
Documented compounds31 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| 1D-chiro-inositol | present | LOTUS | |
| 3',5'-Dihydroxy-2',4',6'-trimethoxydihydrochalcone | present | NPASS | |
| 4,5-Dimethoxy-2-(1-methoxy-3-phenylprop-2-enylidene)cyclopent-4-ene-1,3-dione | present | NPASS | |
| 5,6,7,8-Tetramethoxyflavone | present | NPASS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| 9-Octadecenoic Acid | present | LOTUS | |
| Alnetin | present | NPASS | |
| Benzoic acid | present | LOTUS | |
| Biochanin A | present | LOTUS |
05DNA & barcoding19 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium incarnatum has left across the world's sequence archives.
At a glance
DNA specimens19
Marker genes5
GenBank sequences10
eDNA detections11
Countries6
The DNA barcodea real sequence read deposited for this species
GAAGCCTCTTGCCAATTTCCTATTGATAGGGATTGTGTAGGATGATGCTGGCCTCCCGTGAGCTCCATCGTCTCATGGTTGGTTGAAAAT …
Trifolium incarnatum subsp. molinerii clone TR-25 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Trifolium incarnatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size766 263 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium incarnatum0.77 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–162n range14median14mode47records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1446×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · brit-fl +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — BARTOLO G., BRULLO S., MAJORANA G., PAVONE P. - 1977. Numeri cromosomici per la flora italiana:315-328.. Inform. Bot. Ital. , 9(1): 71-87.
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Estudios cariohistolgicos en el gnero Trifolium. Angulo Carpio, M. D., M. C. de Figueras & A. M. Snchez de Rivera.Bol. Soc. Brot. ser. 253(2): 877-885(1981).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VI Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Lagascalia2(1): 3-13(1972).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VII Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Gent. Ibr.24: 305-324(1972).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2978
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2979
CCDB · ipcn-api-dl — Angulo, M. D., M. C. D. Figueras & A. M. S. Rivera. 1981. Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 885–887.
CCDB · ipcn-api-dl — Badr, A. 1995. Electrophoretic studies of seed proteins in relation to chromosomal criteria and the relationships of some taxa of Trifolium. Taxon 44: 183–191.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Vachova, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — Bartolo, G., S. Brullo, G. MAJORANA & P. PAVONE. 1977. Numeri cromosomici per la flora Italiana: 315-328. Inform. Bot. Ital. 9: 71–87.
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · book-ipcn72 — ANGULO, M.D., A.M. SANCHEZ DE RIVERA, & F. GONZALEZ-BERNALDEZ. 1972. Estudios cromosomicos en el genera Trifolium. VI. Lagascalia 2: 3-13.
CCDB · book-ipcn72 — KOZUHAROV, S.I., B.A. KUZMANOV, T. MARKOVA. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn72 — KUZMANOV, B.A., & G. STANCEV. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn75-78 — Nielsen 197 5
CCDB · book-ipcn75-78 — Kozuharov et al. 1975
CCDB · book-ipcn75-78 — Vachova 197 8
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-ipcn75-78 — Bartolo et al. 1977
CCDB · book-ipcn73-74 — KOZUHAROV, S. I. , A. V. PETROVA, & T. MARKOV A. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · book-atlas-flowering-plants — Fo
CCDB · kew — Vižintin L, Javornik B, Bohanec B. 2006. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Science 170: 859-866.
CCDB · CromoCat 2015 — Angulo, M. D., Figueras, M. C. & Sánchez de Rivera, A. M. (1981). Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 877-885.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1972a). Estudios cromosómicos en el género Trifolium. VI. Lagascalia 2(1): 3-13.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1972b). Estudios cromosómicos en el género Trifolium. VII. Genét. Ibér. 24: 305-324.
CCDB · CromoCat 2015 — Badr, A. (1995). Electrophoretic studies of seeds proteins in relation to chromososmal criteria and the relationships of some taxa of Trifolium Taxon 44(2): 183-191.
CCDB · CromoCat 2015 — Kozuharov, S., Kuzmanov, B. & Markova, T. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVI]. Taxon 21(2/3): 336-337.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1974c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 377-378.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1975b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVII]. Taxon 24(1): 145-146.
+5 more references
2n 161×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 81×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.984 ↗
08Occurrence & distribution
Record type71 751 records
Wild obs. + sensor69 238
Museum / vouchered2 443
Cultivated / captive20
Other50
Origin
Native84
Introduced101
Range
Area of Occupancy AOO157 668 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy70% within 1 km
≤100 m 35 667≤1 km 4 187≤10 km 16 069>10 km 734
56 657 georeferenced · 12 581 without coordinates
Open the mapobservation + sensor69 238
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 172≤1 km 422≤10 km 457>10 km 125
1 176 georeferenced · 1 267 without coordinates
Open the institutions mapphysical evidence2 443
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 3>10 km 3
6 georeferenced · 14 without coordinates
Open the mapnot free-living20
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions178 of 280 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 185 |
| MeiseBGlocation not on record | 95 |
| Oskarshamn, SE | 67 |
| SLU Artdatabankenlocation not on record | 49 |
| Helsinki, FI | 48 |
| Olocation not on record | 45 |
| BFLlocation not on record | 41 |
| BAYLUlocation not on record | 41 |
| Fort Worth, US | 39 |
| Philadelphia, US | 35 |
| Adam Mickiewicz University in Poznańlocation not on record | 35 |
| Museo Entomologico de Leonlocation not on record | 34 |
| College Park, US | 31 |
| Bronx, US | 27 |
| Wuzhou, CN | 27 |
| Chongqing Museumlocation not on record | 27 |
| Bern, CH | 27 |
| BRNUlocation not on record | 26 |
| Provincia di Livornolocation not on record | 24 |
| Mount Annan, AU | 24 |
| Uniwersytet Wrocławskilocation not on record | 23 |
| BIO-UNIPIlocation not on record | 22 |
| Davis, US | 21 |
| Jackson, US | 21 |
| Corvallis, US | 20 |
| Tuscaloosa, US | 19 |
| Mississippi State, US | 18 |
| Riverside, US | 18 |
| Salzburg, AT | 18 |
| PRClocation not on record | 18 |
| Jena Microbial Resource Collectionlocation not on record | 17 |
| Bangkok, TH | 16 |
| Tampa, US | 16 |
| BDBClocation not on record | 16 |
| Dresden, DE | 15 |
| University of New Hampshirelocation not on record | 15 |
| Görlitz, DE | 14 |
| Hobart, AU | 14 |
| Chapel Hill, US | 14 |
| University of Stellenboschlocation not on record | 14 |
| Tartu, EE | 13 |
| Fayetteville, US | 13 |
| Williamsburg, US | 13 |
| Canadian Department of Agriculturelocation not on record | 13 |
| US | 12 |
| WTUlocation not on record | 12 |
| South Kensington, GB | 12 |
| Christchurch, NZ | 12 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 12 |
| Saint Louis, US | 12 |
| Emporia, US | 11 |
| CICYTEXlocation not on record | 11 |
| Pullman, US | 11 |
| BClocation not on record | 11 |
| Norfolk, US | 11 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Brussel, BE | 11 |
| Mlocation not on record | 10 |
| Tsukuba, JP | 10 |
| GAlocation not on record | 10 |
| DBF-NHMDlocation not on record | 10 |
| Zürich, CH | 10 |
| Odawara, JP | 10 |
| EL PASO, US | 10 |
| Columbia, US | 10 |
| San Luis Obispo, US | 10 |
| Portland, US | 9 |
| Frankfurt am Main | 9 |
| Bergen, NO | 9 |
| Wellington, NZ | 9 |
| MAlocation not on record | 9 |
| Arcata, US | 9 |
| Oulu, FI | 8 |
| New Haven, US | 8 |
| Valdosta State Universitylocation not on record | 8 |
| Berlin, DE | 8 |
| University of Southern Mississippilocation not on record | 8 |
| AUAlocation not on record | 8 |
| Knoxville, US | 8 |
| Bloomington, US | 7 |
| Santa Barbara, US | 7 |
| Staten Island, US | 7 |
| San Diego, US | 7 |
| Barcelona, ES | 7 |
| Angwin, US | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Tilburg, NL | 7 |
| CJBGlocation not on record | 6 |
| Austin, US | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Clemson, US | 6 |
| Moscow, US | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Wlocation not on record | 6 |
| UniKSlocation not on record | 6 |
| Moscow State Universitylocation not on record | 6 |
| Burlington, US | 6 |
| GJOlocation not on record | 6 |
| Canberra, AU | 6 |
| Uppsala, SE | 6 |
| Tall Timbers Research Stationlocation not on record | 6 |
| Spearfish, US | 6 |
| PrivatHerblocation not on record | 5 |
| Kochi, JP | 5 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 5 |
| Claremont, US | 5 |
| Millersville, US | 5 |
| Lubbock, US | 5 |
| Denton, US | 5 |
| Nagatoro-machi, Chichibu-gun, JP | 5 |
| Zürich, CH | 5 |
| Porrentruy, CH | 5 |
| Boise, US | 4 |
| Auckland, NZ | 4 |
| Conway, US | 4 |
| Ashland, US | 4 |
| San Jose, US | 4 |
| Salamanca, ES | 4 |
| Beijing, CN | 4 |
| Ann Arbor, US | 4 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 4 |
| Pittsburg, US | 4 |
| Vancouver, CA | 4 |
| Madison, US | 4 |
| Turku, FI | 4 |
| Badajoz, ES | 4 |
| China Agricultural Universitylocation not on record | 4 |
| Flagstaff, US | 4 |
| CASlocation not on record | 4 |
| GZUlocation not on record | 4 |
| Sagamihara, JP | 3 |
| Parkville, AU | 3 |
| Kuopio, FI | 3 |
| Frauenfeld, CH | 3 |
| Minia, EG | 3 |
| ASUlocation not on record | 3 |
| Nijmegen, NL | 3 |
| University of Tennessee at Chattanoogalocation not on record | 3 |
| Dekalb, US | 3 |
| Chiba, JP | 3 |
| Bend, US | 3 |
| Tomioka, JP | 3 |
| McWane Science Centerlocation not on record | 3 |
| Bourges, FR | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| KMNlocation not on record | 3 |
| Yangling, CN | 3 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 3 |
| Portland, US | 3 |
| Edmonton, CA | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Miami, US | 3 |
| SZUlocation not on record | 3 |
| Monastir, TN | 3 |
| Salvador, BR | 3 |
| San Francisco, US | 3 |
| València, ES | 2 |
| Karlsruhe, DE | 2 |
| Palmerston North, NZ | 2 |
| Stockholm, SE | 2 |
| Podgorica, ME | 2 |
| Fairfax, US | 2 |
| Lake Charles, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Kunming, CN | 2 |
| Québec, CA | 2 |
| Nagano City, JP | 2 |
| Kew, GB | 2 |
| Irvine, US | 2 |
| Logan, US | 2 |
| San Isidro, AR | 2 |
| Philadelphia, US | 2 |
| Guangzhou, CN | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Tallinn, EE | 2 |
| Oswego, US | 2 |
| Sanda, JP | 2 |
| Urumqi, CN | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Santa Cruz, US | 2 |
| Kensington, AU | 2 |
| Hudson, US | 2 |
| St. Paul, US | 2 |
| PUC-RSlocation not on record | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Fulda, DE | 2 |
| Northridge, US | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| ESP119location not on record | 2 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| H-AkrKGlocation not on record | 2 |
| Los Angeles, US | 2 |
| Vitoria, ES | 2 |
| Paris, FR | 1 |
| nbflocation not on record | 1 |
| GB | 1 |
| La Paz, BO | 1 |
| Tulane Universitylocation not on record | 1 |
| TUR-Alocation not on record | 1 |
| Whitehorse, CA | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Armidale, AU | 1 |
| Tempe, US | 1 |
| Due West, US | 1 |
| Philadelphia, US | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Cambridge, US | 1 |
| Jyväskylä, FI | 1 |
| Albuquerque, US | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| München, DE | 1 |
| NMBU:MINAlocation not on record | 1 |
| KOMlocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Asheville, US | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Glarus, CH | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| H-HarzKurtlocation not on record | 1 |
| Phoenix, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Durham, US | 1 |
| Jaén, ES | 1 |
| KURAlocation not on record | 1 |
| Saint John, CA | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Gijón, ES | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Little Rock, US | 1 |
| Turlock, US | 1 |
| Coimbra, PT | 1 |
| Montréal, CA | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| UChlocation not on record | 1 |
| Taipei, TW | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Henderson, US | 1 |
| Porvoo, FI | 1 |
| Chadron, US | 1 |
| San Angelo, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Victoria, CA | 1 |
| Shinshu Universitylocation not on record | 1 |
| Stephenville, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Toronto, CA | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Pocatello, US | 1 |
| BMlocation not on record | 1 |
| Conway, US | 1 |
| Sion, CH | 1 |
| JP | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Provo, US | 1 |
| Urumqi, CN | 1 |
| Denver, US | 1 |
| Trondheim, NO | 1 |
| Chicago, US | 1 |
| Banyoles, ES | 1 |
| Keene State Universitylocation not on record | 1 |
| Xiamen, CN | 1 |
| Hiratsuka City Museumlocation not on record | 1 |
| Washington, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Göteborg, SE | 1 |
| US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Madrid, ES | 1 |
| MKD001location not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
280 institutions · 2 195 of 2 443 vouchered records shown · 225 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Trifolium incarnatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map4 countries0
sea cliffBorders of fields.disturbed grassland, granitic
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 11.8–15.9
Seasonal swing summer↔winter15.3 °C
Max temp (day)20.5 °C 14.9–22.8
Min temp (night)10.4 °C 8.80–10.9
Precipitation70.4 mm/mo 34.8–85.0
Air humidity57.7 % 56.3–62.2
Moisture balance-14.9 mm/mo
Vapour deficit755 Pa 545–813
Wind speed3.30 m/s
Cloud cover41.0 % 32.3–45.7
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.