Trifolium hybridum
speciesAt a glance
Occurrence records155 575
Data sources14
Biological traits142
DNA specimens65
eDNA detections33
Sources14 archives
Databases and archives Trifolium hybridum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility155 575 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics65 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources142 traits
Chemical compositionLOTUS · NPASS56 compounds
Occurrence & distributionGBIF155 575 records
Environmental DNA1 datasets · 5 countries33 detections
DNA & barcodingBOLD · NCBI65 specimens
Genome at a glanceCCDB · GIFT · GoaT695 Mbp
01Narrative
Le Trèfle hybride est une espèce de plante à fleurs du genre Trifolium et de la famille des Fabacées. C'est une plante herbacée prairiale, annuelle ou bisannuelle, fréquemment utilisée comme fourrage. Son nom provient du fait que Linné avait pensé qu'il s'agissait d'un hybride entre le trèfle blanc et le trèfle violet. Le trèfle hybride est une plante cultivée.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology23
Fruit length3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 4 mm
Leaf length20 mm
Leaf length max78 mm
Leaf length min10 mm
Leaf mass64.35 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 1 964 mm² · GIFT: 1 676 mm²
Leaf width14 mm
Leaf width max18 mm
Leaf width min10 mm
Plant height0.42 m
⚠ sources differ — GIFT: 0.42 m · AusTraits: 0.4 m · LEDA: 0.35 m · USDA: 0.61 m · TRY: 0.24 m
Plant height generative0.483 m
Plant height max0.9 m
Plant height min0.1 m
Seed length1.37 mm
Seed mass0.7 mg
⚠ sources differ — TRY: 0.7 mg · LEDA: 0.931 mg · GIFT: 0.755 mg
Seed mass max1.13 mg
Seed mass min0.6 mg
Seed volume0.57 mm³
Seed volume max0.57 mm³
Seed volume min0.57 mm³
Seed width1.25 mm
Seed width max1.25 mm
Seed width min1.25 mm
Life cycle & reproduction36
After harvest regrowth rateModerate
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colourwhite
Flower conspicuousYes
Flowering endSep
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDARapid
Life formperennial or annual
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual perennial · LEDA: perennials · GIFT: perennial
Lifespan categoryShort
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number318
Seed spread rateSlow
Seedling vigorMedium
Self fertilizationabsent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment33
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatHigh
Climatetemperate
Climberself-supporting
Elevation max1 750 m
Elevation mean2 600 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
Growth form USDASingle Crown
Habitat GIFTcrop fields, meadows, meadows: wet, shrubberies
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesscompound
Leaf retentionNo
Leaf shapeelliptical obovate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceHigh
C:N ratioLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min50 days
Leaf C:N ratio10.81 g/g
Leaf c452 mg/g
Leaf dry-matter content (LDMC)233 mg/g
⚠ sources differ — TRY: 233 mg/g · LEDA: 262 mg/g
Leaf n38.8 mg/g
Moisture useHigh
Nitrogen fixation levelHigh
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min26 in
Protein potentialHigh
Salinity toleranceLow
Seed longevity index0.25
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min5.6 pH
Specific leaf area (SLA)23.34 mm²/mg
⚠ sources differ — TRY: 23.34 mm²/mg · LEDA: 25.4 mm²/mg · GIFT: 24.9 mm²/mg
Temperature min-38 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound680 400 per lb
ToxicitySlight
Veneer productNo
Other traits6
Diaspore typegerminule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Shoot orientationascending
03Chemical composition56 compounds
Compounds documented for Trifolium hybridum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Stigmastane steroids7
Lanostane, Tirucallane and Euphane triterpenoids5
Flavonols4
Germacrane sesquiterpenoids4
Elemane sesquiterpenoids3
Documented compounds56 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Caryophyllene | present | NPASS | |
| (1R,2S,8R,12S)-12-ethenyl-2-hydroxy-5,12-dimethyl-9-methylidene-3,11-dioxatricyclo[6.3.1.02,6]dodec-5-ene-4,10-dione | present | NPASS | |
| (1S,3R,6S,8R,11R,12S,15R,16R)-15-[(2R)-6,6-dimethyl-5-methylideneheptan-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol | present | NPASS | |
| (1S,3R,6S,8R,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methyl-5-methylideneheptan-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol | present | NPASS | |
| (1S,3R,6S,8R,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol | present | NPASS | |
| (1S,3R,6S,8R,11S,12S,15R,16R)-15-[(2R,5S)-5-ethyl-6-methylhept-6-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol | present | NPASS | |
| (2R,3S)-2-(3,4-Dihydroxyphenyl)-3,5,7-Trihydroxy-2,3-Dihydrochromen-4-One | present | NPASS | |
| (3beta)-24-Methylenelanost-9(11)-en-3-ol | present | NPASS | |
| (3S,4aS,8aS)-8a-methyl-5-methylidene-3-prop-1-en-2-yl-1,2,3,4,4a,6,7,8-octahydronaphthalene | present | NPASS | |
| (3S,4S,5S,8S,10S,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-4,10,13,14-tetramethyl-1,2,3,4,5,6,7,8,12,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-ol | present | NPASS |
05DNA & barcoding65 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium hybridum has left across the world's sequence archives.
At a glance
DNA specimens65
Marker genes7
GenBank sequences10
eDNA detections33
Countries7
The DNA barcodea real sequence read deposited for this species
AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACACGTGAATCAGTTTGAACACATAGGGTTGG …
Trifolium hybridum bio-material MFFGC AB525 from Georgia small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★trnL-F★ITS9★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Trifolium hybridum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size695 358 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium hybridum0.70 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–322n range16median16mode53records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1650×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +16
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Chromosome studies in some flowering plants collected in the French Alps (haute Savoie).. Rev. Gn. Bot. , 77: 487-497.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2960
CCDB · fl-europaea — Gadella &
CCDB · poland — Kazimierski T., Kazimierska E. M. and Strzy?ewska C. 1972. Species crossing in the genus\nTrifolium L. Gen. Pol. 13, 11-32.
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Angulo, M. D. & M. C. D. Figueras. 1983. Nota complementaria sobre números cromosómicos y de sacos polínicos en especies de Trifolium. Genét. Ibér. 35: 75–86.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · ipcn-api-dl — Semerenko, L. V. 1989. Chromosome numbers in some members of the families Asteraceae, Fabaceae, Orchidaceae and Poaceae from the Berezinsky Biosphere Reservation (Byelorussia) flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1671–1673.
CCDB · ipcn-api-dl — Semerenko, L. V. & I. V. Shvets. 1989. Karyologicheskoe isuchenie bobovykh (Fabaceae) Belorussii. Pp. 66--68 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Muñoz Rodriguez, A. F. 1996. Trifolium sect. Paramesus y sect. Trifoliastrum en la Península Ibérica. II. Estudio cariológico. Stud. Bot. Univ. Salamanca 14: 103–128.
CCDB · ipcn-api-dl — Vachova, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · ipcn-api-dl — Probatova, N. S. 2000. Chromosome numbers in some plant species from the Razdolnaya (Suifun) river basin (Primorsky Territory). Bot. Žhurn. (Moscow & Leningrad) 85(12): 102–107.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · book-ipcn72 — KUZMANOV, B.A., & G. STANCEV. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Chromosome studies in some flowering plants collected in the French Alps (Hante Savoie). Rev. Gen. Bot. 77: 487-497.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn75-78 — Kozuharov et al. 1975
CCDB · book-ipcn75-78 — Vachova 1978
CCDB · book-ipcn75-78 — Nielsen 1975
CCDB · book-northern-plants — Frandsen 1945.
CCDB · book-ipcn73-74 — CHEN, C.-C., & P.B. GIBSON. 1971. Karyotypes of fifteen Trifolium species in section Amoria. Crop Sci. 11: 441-445.
CCDB · book-ipcn73-74 — KOZUHAROV, S. I. , A. V. PETROVA, & T. MARKOV A. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · book-atlas-flowering-plants — Kawakami 1930
CCDB · kew — Vižintin L, Javornik B, Bohanec B. 2006. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Science 170: 859-866.
CCDB · Cave1956 — Love & Love b
CCDB · Cave1963 — Tures son 1962
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1974c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 377-378.
+6 more references
2n 323×CCDB · CromoCat 2015 · GIFT · GIFT (floras)
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Przywara, L., D. W. R. White, P. M. Sanders & D. Maher (1989). Interspecific hybridization of Trifolium repens with T. hybridum using in ovulo embryo and embryo culture Ann. Bot. (London) 64: 613–624
GIFT · GIFT (floras)
n 84×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · book-ipcn65 — Katznelson & M. 1965
CCDB · ipcn-api-dl — Williams, E. G. 1980. Hybrids between Trifolium ambigaum and T. hybridum obtained with the aid of embryo culture. New Zealand J. Bot. 18: 215–220.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Williams, E. G. (1980). Hybrids between Trifolium ambigaum and T. hybridum obtained with the aid of embryo culture New Zealand J. Bot. 18: 215–220
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.992 ↗
08Occurrence & distribution
Record type155 575 records
Wild obs. + sensor144 022
Museum / vouchered10 493
Cultivated / captive127
Other933
Origin
Native388
Introduced5 839
Range
Area of Occupancy AOO320 892 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy51% within 1 km
≤100 m 34 014≤1 km 27 882≤10 km 56 931>10 km 1 743
120 570 georeferenced · 23 452 without coordinates
Open the mapobservation + sensor144 022
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy36% within 1 km
≤100 m 607≤1 km 1 786≤10 km 3 609>10 km 694
6 696 georeferenced · 3 797 without coordinates
Open the institutions mapphysical evidence10 493
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy59% within 1 km
≤1 km 36≤10 km 4>10 km 21
61 georeferenced · 66 without coordinates
Open the mapnot free-living127
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions196 of 338 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 972 |
| Helsinki, FI | 483 |
| LDlocation not on record | 393 |
| Moscow State Universitylocation not on record | 359 |
| BFLlocation not on record | 331 |
| Olocation not on record | 250 |
| Salzburg, AT | 226 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 198 |
| Philadelphia, US | 182 |
| Chongqing Museumlocation not on record | 165 |
| Uniwersytet Warszawskilocation not on record | 157 |
| Oskarshamn, SE | 137 |
| Madison, US | 128 |
| St. Paul, US | 119 |
| Jyväskylä, FI | 111 |
| Oulu, FI | 110 |
| Bergen, NO | 103 |
| MeiseBGlocation not on record | 98 |
| Bronx, US | 97 |
| Turku, FI | 92 |
| Trondheim, NO | 81 |
| TROMlocation not on record | 79 |
| Québec, CA | 78 |
| Wuzhou, CN | 77 |
| Denver, US | 69 |
| WTUlocation not on record | 68 |
| Görlitz, DE | 67 |
| Bern, CH | 66 |
| Museo Entomologico de Leonlocation not on record | 64 |
| KMNlocation not on record | 63 |
| Kuopio, FI | 62 |
| SLU Artdatabankenlocation not on record | 60 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 57 |
| Pullman, US | 54 |
| Ann Arbor, US | 50 |
| BRNUlocation not on record | 50 |
| TUR-Alocation not on record | 48 |
| Provincia di Livornolocation not on record | 48 |
| Odawara, JP | 48 |
| Saint John, CA | 46 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 46 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 45 |
| Nagano City, JP | 45 |
| Bloomington, US | 43 |
| Montréal, CA | 42 |
| Université Lavallocation not on record | 39 |
| Missoula, US | 38 |
| Albuquerque, US | 38 |
| Acadia Universitylocation not on record | 38 |
| Moscow, US | 37 |
| Corvallis, US | 37 |
| SWE054location not on record | 37 |
| Burlington, US | 36 |
| Christchurch, NZ | 36 |
| College Park, US | 34 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 34 |
| University of New Hampshirelocation not on record | 31 |
| Shinshu Universitylocation not on record | 30 |
| Saint Louis, US | 30 |
| Bangkok, TH | 30 |
| Green Bay, US | 30 |
| University of Stellenboschlocation not on record | 30 |
| University of Alberta Museumslocation not on record | 30 |
| Mlocation not on record | 30 |
| Bozeman, US | 29 |
| New Haven, US | 29 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 27 |
| Porvoo, FI | 27 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 27 |
| Kew, GB | 27 |
| Uppsala, SE | 26 |
| Wlocation not on record | 26 |
| Chadron, US | 26 |
| Boise, US | 26 |
| Allentown, US | 26 |
| South Kensington, GB | 25 |
| Berlin, DE | 25 |
| Karlsruhe, DE | 24 |
| Voronezh State Universitylocation not on record | 23 |
| Chiba, JP | 23 |
| Tallinn, EE | 21 |
| Davis, US | 19 |
| Provo, US | 19 |
| Tsukuba, JP | 18 |
| Riverside, US | 18 |
| Garðabær, IS | 17 |
| IDElocation not on record | 17 |
| Vancouver, CA | 17 |
| Brussel, BE | 17 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 16 |
| Anchorage, US | 16 |
| Beijing, CN | 16 |
| Victoria, CA | 16 |
| Canadian Department of Agriculturelocation not on record | 15 |
| Toronto, CA | 15 |
| Spearfish, US | 15 |
| Santa Cruz, US | 14 |
| Tula State Universitylocation not on record | 14 |
| Williamsburg, US | 14 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 14 |
| JP | 14 |
| Kushiro City Museumlocation not on record | 13 |
| New Brunswick, US | 13 |
| Toyama, JP | 13 |
| DOI/NPS, Greenbelt Parklocation not on record | 12 |
| Frankfurt am Main | 12 |
| WINlocation not on record | 12 |
| KIRMlocation not on record | 12 |
| Flagstaff, US | 12 |
| Uniwersytet Śląski w Katowicachlocation not on record | 12 |
| Pocatello, US | 12 |
| McWane Science Centerlocation not on record | 11 |
| CZE096location not on record | 11 |
| Pittsburg, US | 11 |
| GJOlocation not on record | 11 |
| CICYTEXlocation not on record | 10 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 10 |
| Claremont, US | 10 |
| SZUlocation not on record | 9 |
| Emporia, US | 9 |
| Philadelphia, US | 9 |
| ASUlocation not on record | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Glarus, CH | 8 |
| GBR016location not on record | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Caldwell, US | 8 |
| EL PASO, US | 8 |
| Keene State Universitylocation not on record | 8 |
| HUN003location not on record | 8 |
| GB | 7 |
| Santa Barbara, US | 7 |
| Portland, US | 7 |
| Bando, JP | 7 |
| Davenport, US | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Chicago, US | 7 |
| Cheney, US | 7 |
| Tacoma, US | 7 |
| Arcata, US | 7 |
| Lincoln, US | 7 |
| Chapel Hill, US | 7 |
| BClocation not on record | 6 |
| 6 | |
| Yukon Universitylocation not on record | 6 |
| València, ES | 6 |
| Staten Island, US | 6 |
| Zhengzhou, CN | 6 |
| Hunan Hupingshan National Nature Reservelocation not on record | 6 |
| Auckland, NZ | 6 |
| Tomioka, JP | 6 |
| Guangzhou, CN | 6 |
| Bourges, FR | 6 |
| Angwin, US | 6 |
| Otaru, JP | 6 |
| Rovaniemi, FI | 6 |
| Washington, US | 6 |
| Rocky Mountain Biological Laboratorylocation not on record | 6 |
| Osaka, JP | 6 |
| Tartu, EE | 6 |
| Tilburg, NL | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Institute of the biological problems of the North FEB RASlocation not on record | 5 |
| Whitewater, US | 5 |
| US | 5 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| University of British Columbia, Herbariumlocation not on record | 5 |
| Forssa, FI | 5 |
| Knoxville, US | 5 |
| University of Lethbridgelocation not on record | 5 |
| Porrentruy, CH | 5 |
| Millersville, US | 5 |
| Logan, US | 5 |
| MAlocation not on record | 5 |
| Dekalb, US | 5 |
| Hobart, AU | 5 |
| USFS/BHSClocation not on record | 5 |
| Canberra, AU | 4 |
| DBF-NHMDlocation not on record | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| San Isidro, AR | 4 |
| BIO-UNIPIlocation not on record | 4 |
| Fulda, DE | 4 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 4 |
| Podgorica, ME | 4 |
| Hiratsuka City Museumlocation not on record | 4 |
| Guilin, CN | 4 |
| Norfolk, US | 4 |
| ROM007location not on record | 4 |
| Northridge, US | 4 |
| San Sebastián, ES | 4 |
| POL003location not on record | 4 |
| CASlocation not on record | 4 |
| Fayetteville, US | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Tampa, US | 4 |
| Northeastern Forestry Universitylocation not on record | 4 |
| Nijmegen, NL | 4 |
| Grand Junction, US | 3 |
| BAYLUlocation not on record | 3 |
| Kandalaksha State Nature Reservelocation not on record | 3 |
| Philadelphia, US | 3 |
| Durham, US | 3 |
| GZUlocation not on record | 3 |
| Richmond, US | 3 |
| Namur, BE | 3 |
| Centre for Biodiversity Genomicslocation not on record | 3 |
| Waverly, US | 3 |
| Stockholm, SE | 3 |
| Phoenix, US | 3 |
| Yangling, CN | 3 |
| Kirksville, US | 3 |
| CJBGlocation not on record | 3 |
| Kingston, US | 3 |
| Ashland, US | 3 |
| Chicago, US | 3 |
| Tuscaloosa, US | 3 |
| SVK001location not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| Whitehorse, CA | 3 |
| Paris, FR | 3 |
| KURAlocation not on record | 3 |
| Barcelona, ES | 3 |
| Dresden, DE | 3 |
| AASlocation not on record | 3 |
| Mississippi State, US | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Wellington, NZ | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| BDBClocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| PRClocation not on record | 2 |
| Sanda, JP | 2 |
| Minia, EG | 2 |
| Yellowstone National Park Herbariumlocation not on record | 2 |
| Valdosta State Universitylocation not on record | 2 |
| Fairfax, US | 2 |
| Orem, US | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Los Angeles, US | 2 |
| Dhaka, BD | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Dover, US | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Palmerston North, NZ | 2 |
| Tromso University Museumlocation not on record | 2 |
| Durango, US | 2 |
| Chengdu, CN | 2 |
| Morgantown, US | 2 |
| Zürich, CH | 2 |
| Chicago, US | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Hamilton, US | 2 |
| San Jose, US | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Weber State Universitylocation not on record | 2 |
| Mount Annan, AU | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| nbflocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Smithsonian Institutionlocation not on record | 2 |
| Ypsilanti, US | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Henderson, US | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Austin, US | 1 |
| Springfield, US | 1 |
| Göteborg, SE | 1 |
| Brookings, US | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Nishihara, JP | 1 |
| Miami, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Madrid, ES | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Edmonton, CA | 1 |
| Salvador, BR | 1 |
| Sendai, JP | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Elikins, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| SVN019location not on record | 1 |
| Asheville, US | 1 |
| Jackson, US | 1 |
| Nanjing, CN | 1 |
| Macomb, US | 1 |
| Clemson, US | 1 |
| Córdoba, AR | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| Adelaide, AU | 1 |
| Sapporo, JP | 1 |
| San Luis Obispo, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Lausanne, CH | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Pomona Collegelocation not on record | 1 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Sucre, BO | 1 |
| Madrid, ES | 1 |
| San Angelo, US | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Fort Bragg, US | 1 |
| GAlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Salamanca, ES | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| US | 1 |
| Kensington, AU | 1 |
| Xiamen, CN | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Hudson, US | 1 |
| Fukushima Universitylocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Turlock, US | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| VALElocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Columbia, US | 1 |
| Taipei, TW | 1 |
| Cincinnati, US | 1 |
338 institutions · 9 478 of 10 493 vouchered records shown · 811 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA33 detections
Where the DNA of Trifolium hybridum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found33
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 33 detections have coordinates
Open the map5 countries0
Managed boreal mixedwood standMarshy wetland at lakeside, with Carex, Poac…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.1 °C 5.80–18.2
Seasonal swing summer↔winter25.5 °C
Max temp (day)15.6 °C 10.9–24.0
Min temp (night)8.70 °C 1.70–13.7
Precipitation75.4 mm/mo 48.0–96.1
Air humidity59.5 % 53.2–63.7
Moisture balance-21.6 mm/mo -73.0–20.9
Vapour deficit593 Pa 465–898
Wind speed2.70 m/s 2.10–4.30
Cloud cover46.6 % 33.1–51.7
CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.