Trifolium cherleri
speciesAt a glance
Occurrence records9 108
Data sources11
Biological traits37
DNA specimens6
eDNA detections3
Sources11 archives
Databases and archives Trifolium cherleri's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 108 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics6 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources37 traits
Chemical compositionLOTUS3 compounds
Occurrence & distributionGBIF9 108 records
Environmental DNA1 datasets · 1 countries3 detections
DNA & barcodingBOLD · NCBI6 specimens
Genome at a glanceCCDB2n = 10
01Narrative
Trifolium cherleri, the cupped clover, is a species of flowering plant in the family Fabaceae. It is native to the Canary Islands, the Mediterranean, and the Middle East as far east as Iran, and it has been introduced to Australia as a forage. Three cultivars have been developed in Australia; 'Beenong', 'Yamina' and 'Lisare'.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVPAusTraits
Size & morphology10
Fruit length1.75 mm
Leaf length15.5 mm
Leaf length max15 mm
Leaf width max9 mm
Plant height0.125 m
⚠ sources differ — AusTraits: 0.125 m · TRY: 0.08 m
Plant height max0.3 m
Plant height min0.02 m
Seed mass3.12 mg
⚠ sources differ — TRY: 3.12 mg · LEDA: 1.34 mg · GIFT: 2.56 mg
Seed mass max4.54 mg
Seed mass min3.03 mg
Life cycle & reproduction7
Deciduousnessdeciduous
Flower colourpink
Flowering endJun
Flowering startMar
Life formannual
Life spanannual
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typelegume
Growth formherb
Leaf compoundnesscompound
Leaf formobovate
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio17.74 g/g
Leaf c446 mg/g
Leaf dry-matter content (LDMC)265 mg/g
Leaf n25.17 mg/g
Leaf p0.75 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)24.59 mm²/mg
Other traits1
Shoot orientationascending
03Chemical composition3 compounds
Compounds documented for Trifolium cherleri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Pterocarpan3
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| Medicarpin | present | LOTUS |
05DNA & barcoding6 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium cherleri has left across the world's sequence archives.
At a glance
DNA specimens6
Marker genes5
GenBank sequences8
eDNA detections3
Countries3
The DNA barcodea real sequence read deposited for this species
ATCGAAGCCTCTCGCCAAATTCCTATATTGATAGGGGTATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTTCATCGCCTCATGGTTGG …
Trifolium cherleri internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★ITS8★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Trifolium cherleri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Ploidydiploid inferred
Chromosome records10–162n range10median10mode40records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1038×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4
CCDB · iber-fl — Estudios cariohistolgicos en el gnero Trifolium. Angulo Carpio, M. D., M. C. de Figueras & A. M. Snchez de Rivera.Bol. Soc. Brot. ser. 253(2): 877-885(1981).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Anales Estac. Exp. Aula Dei9: 97-110(1969).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VII Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Gent. Ibr.24: 305-324(1972).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · ipcn-api-dl — Angulo, M. D., M. C. D. Figueras & A. M. S. Rivera. 1981. Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 885–887.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982a. Cytotaxonomic study of Trifolium L.: Bulgaria II. Fitologija 20: 20–40. (In Bulgarian).
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · ipcn-api-dl — Slavĭk, B., V. Jarolĭmovă & J. Chrtek. 1993. Chromosome counts of some plants from Cyprus. Candollea 48(1): 221–230.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · book-ipcn67-71 — PRITCHARD, A. J. 1967. The somatic chromosomes of Trifolium cherleri L., ! hirtum All.,! ligusticum Balb., and! scabrum L. Caryologia 20: 323-331.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn75-78 — Kozuharov et al. 1975
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-ipcn75-78 — Nielsen 1975
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn73-74 — ANGULO, M.D., A.M. SANCHEZ DE RIVERA, & F. GONZALEZ BERNALDEZ. 1969. Estudios cromosomicos en el genero Trifolium. Anales Estac. Exp. Aula Dei 9: 97-110.
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-ipcn73-74 — KOZUHAROV, S. I. , A. V. PETROVA, & T. MARKOV A. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · CromoCat 2015 — Angulo, M. D., Figueras, M. C. & Sánchez de Rivera, A. M. (1981). Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 877-885.
CCDB · CromoCat 2015 — Angulo, M. D. & Figueras, M. C. (1979). Números cromosómicos y sacos polínicos en especies del género Trifolium. Genét. Ibér. 31: 129-160.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1969). Estudios cromosómicos en el género Trifolium. Anales Estac. Exp. Aula Dei 9: 97-110.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1972b). Estudios cromosómicos en el género Trifolium. VII. Genét. Ibér. 24: 305-324.
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1975). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Bol. Soc. Brot. 49: 173-196.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1974c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 377-378.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1975b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVII]. Taxon 24(1): 145-146.
CCDB · CromoCat 2015 — Muñoz Rodríguez, A. F. (1993a). Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89-118.
CCDB · CromoCat 2015 — Nielsen, I. (1975). Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180-183.
CCDB · CromoCat 2015 — Petrova, A. & S. Kozuharov. (1982). Cytotaxonomic study of genus Trifolium L. in Bulgaria. I. II. Phytology 19: 3-23; 20: 20-41.
CCDB · CromoCat 2015 — Pritchard, A. J. (1967). The somatic chromosomes of Trifolium cherleri L., T. hirtum All., T. ligusticum Balb., and T. scabrum L. Caryologia 20: 323-331.
CCDB · iapt — IAPT/IOPB Chromosome Data 34
2n 162×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.992 ↗
08Occurrence & distribution
Record type9 108 records
Wild obs. + sensor6 816
Museum / vouchered1 456
Cultivated / captive425
Other411
Origin
Native88
Introduced9
Range
Area of Occupancy AOO17 836 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy54% within 1 km
≤100 m 2 030≤1 km 683≤10 km 2 281>10 km 56
5 050 georeferenced · 1 766 without coordinates
Open the mapobservation + sensor6 816
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 25≤1 km 165≤10 km 127>10 km 15
332 georeferenced · 1 124 without coordinates
Open the institutions mapphysical evidence1 456
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 24>10 km 9
33 georeferenced · 392 without coordinates
Open the mapnot free-living425
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions34 of 62 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 259 |
| ESP010location not on record | 225 |
| BIO-UNIPIlocation not on record | 178 |
| LDlocation not on record | 131 |
| Badajoz, ES | 65 |
| CICYTEXlocation not on record | 51 |
| MAlocation not on record | 46 |
| BDBClocation not on record | 37 |
| BClocation not on record | 35 |
| Museo Entomologico de Leonlocation not on record | 32 |
| Kew, GB | 29 |
| College of the Atlantic, Museumlocation not on record | 28 |
| València, ES | 27 |
| Adelaide, AU | 24 |
| ISAlocation not on record | 24 |
| Córdoba, ES | 20 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| Wlocation not on record | 15 |
| Barcelona, ES | 14 |
| BRNUlocation not on record | 14 |
| Salamanca, ES | 14 |
| Madrid, ES | 14 |
| Entomological Society of Latvialocation not on record | 13 |
| Granada, ES | 12 |
| Phyletisches Museum Jenalocation not on record | 11 |
| CJBGlocation not on record | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 8 |
| Coimbra, PT | 7 |
| Kensington, AU | 7 |
| Mount Annan, AU | 6 |
| Paris, FR | 6 |
| Museo Achille Folettolocation not on record | 4 |
| Sevilla, ES | 4 |
| UIBlocation not on record | 4 |
| Alicante, ES | 4 |
| Philadelphia, US | 3 |
| Vitoria, ES | 3 |
| Armidale, AU | 3 |
| Canberra, AU | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| South Kensington, GB | 3 |
| Rishon Le Zion, IL | 2 |
| Göteborg, SE | 2 |
| JBSlocation not on record | 2 |
| Santiago de Compostela, ES | 2 |
| Santa Cruz, US | 2 |
| Görlitz, DE | 2 |
| Bourges, FR | 2 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Frankfurt am Main | 1 |
| Jaén, ES | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Dresden, DE | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Chapel Hill, US | 1 |
| Wellington, NZ | 1 |
| Moscow State Universitylocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| CIBIOlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| San Sebastián, ES | 1 |
62 institutions · 1 439 of 1 456 vouchered records shown · 17 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA3 detections
Where the DNA of Trifolium cherleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 15.4–15.4
Seasonal swing summer↔winter16.9 °C
Max temp (day)20.4 °C
Min temp (night)9.10 °C
Precipitation66.7 mm/mo
Air humidity56.0 %
Moisture balance-69.0 mm/mo
Vapour deficit774 Pa
Wind speed2.80 m/s
Cloud cover37.6 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.