Trifolium campestre
Schreb. · speciesAt a glance
Occurrence records307 001
Data sources11
Biological traits74
DNA specimens66
eDNA detections64
Sources11 archives
Databases and archives Trifolium campestre's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility307 001 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI64 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics66 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources74 traits
Chemical compositionLOTUS5 compounds
Occurrence & distributionGBIF307 001 records
Environmental DNA3 datasets · 9 countries64 detections
DNA & barcodingBOLD · NCBI66 specimens
Genome at a glanceCCDB · GoaT401 Mbp
01Narrative
Le trèfle couché ou trèfle champêtre est une espèce de plantes à fleurs de la famille des Fabaceae et du genre Trifolium. C'est une plante herbacée aux fleurs jaune doré commune en Europe. Autres noms : trèfle jaune, trèfle des champs, trance, triboulet.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology24
Fruit length1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 2 mm
Leaf length12 mm
Leaf length max20 mm
Leaf length min8 mm
Leaf mass6.47 mg
Leaf mass per area23.92 g/m2
Leaf size244 mm²
⚠ sources differ — TRY: 244 mm² · LEDA: 196 mm² · GIFT: 181 mm²
Leaf width6 mm
Leaf width max12 mm
Leaf width min4 mm
Plant height0.288 m
⚠ sources differ — GIFT: 0.288 m · AusTraits: 0.3 m · LEDA: 0.287 m · TRY: 0.13 m
Plant height generative0.15 m
Plant height max0.4 m
Plant height min0.03 m
Seed length1.23 mm
⚠ sources differ — TRY: 1.23 mm · AusTraits: 1.1 mm
Seed mass0.313 mg
⚠ sources differ — TRY: 0.313 mg · AusTraits: 0.3 mg · LEDA: 0.326 mg · GIFT: 0.329 mg
Seed mass max0.5 mg
Seed mass min0.2 mg
Seed volume1.2 mm³
Seed volume max1.2 mm³
Seed volume min1.2 mm³
Seed width1 mm
Seed width max1 mm
Seed width min1 mm
Life cycle & reproduction20
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colourbrown
Flower length max7 mm
Flower length min5 mm
Flowering endSep
Flowering startMay
Flowering timennnnnnnnnnyn
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number86
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 600 m
Elevation mean1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: forb-annual
Habitat GIFTcrop fields, meadows, rivers, sand, stony places
Leaf compoundnesscompound
Leaf formobovate
Leaf shapeobovate rhomboidal
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio13.85 g/g
Leaf c453 mg/g
Leaf dry-matter content (LDMC)230 mg/g
⚠ sources differ — TRY: 230 mg/g · LEDA: 258 mg/g
Leaf n37.81 mg/g
Leaf p1.41 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)31.27 mm²/mg
⚠ sources differ — TRY: 31.27 mm²/mg · LEDA: 28.8 mm²/mg · GIFT: 27.08 mm²/mg
Other traits3
Diaspore typeone-seeded generative dispersule
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition5 compounds
Compounds documented for Trifolium campestre across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Flavan-3-ols2
Monomeric stilbenes2
Prenyl quinone meroterpenoids1
Documented compounds5 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 5-(2-(4-Hydroxyphenyl)Ethenyl)Benzene-1,3-Diol | present | LOTUS | |
| Covi-Ox | present | LOTUS | |
| Flavan-3,3',4',5,5',7-hexol | present | LOTUS | |
| Gallocatechin | present | LOTUS | |
| trans-resveratrol | present | LOTUS |
05DNA & barcoding66 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium campestre has left across the world's sequence archives.
At a glance
DNA specimens66
Marker genes7
GenBank sequences9
eDNA detections64
Countries11
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACATATCGAAGCCTTTTG …
Trifolium campestre subsp. campestre voucher PLT.0152 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★trnL-F★ITS8★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Trifolium campestre carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size400 980 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium campestre0.40 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–162n range14median14mode95records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1494×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +18
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — DE LEONARDIS W., PAVONE P., TERRASI M.C., ZIZZA A. - 1983 (1981). Numeri cromosomici per la flora italiana:814-830.. Inform. Bot. Ital. , 13(2-3): 158-167.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Králik E. & Kothajová H., 2000: Karyologické štúdium slovenskej flóry XXXIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 37-41.
CCDB · iapt — IAPT/IOPB Chromosome Data 1
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2969
CCDB · fl-europaea — Kliphuis, 1962
CCDB · poland — Pogan E., Jankun A., Tura?a-Szybowska K. et al. 1987. Further studies in chromosome numbers of Polish Angiosperms. Part XX. Acta Biol. Cracov. Ser. Bot. 29,1-17.
CCDB · mediterranean
CCDB · ipcn-api-dl — Reddy, V. R. K. 1989. Karyomorphological studies in Indigofera and Trifolium. J. Cytol. Genet. 24: 30–35.
CCDB · ipcn-api-dl — De Leonardis, W., P. Pavone, M. C. Terrasi & A. Zizza. 1981. Numeri cromosomici per la Flora Italiana: 814-830. Inform. Bot. Ital. 13: 158–167.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & K. TurasLa-Szybowska. 1987. Further studies in chromosome numbers of Polish angiosperms. Part XX. Acta Biol. Cracov., Ser. Bot. 29: 1–17.
CCDB · ipcn-api-dl — Taylor, N. L., J. M. Gillett & N. Giri. 1983. Morphological observations and chromosome numbers in Trifolium L. section Chronosemium Ser. Cytologia 48: 671–677.
CCDB · ipcn-api-dl — Afzal-Raf;auu, Z., J. Vianot, M. Ramade & M. P. Bourreil. 1985. Analyses des charactères caryologiques et écologiques de quelques taxons dans les massifs du Lubéron, de Lure et du Mont-Ventoux. Rev. Cytol. Biol. Veg. Bot. 8: 33–62.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Issolah, R. & A. Abdelguerfi. 1999. Chromosome numbers within some spontaneous populations of 10 Trifolium species in Algeria. Caryologia 52: 151–154.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · ipcn-api-dl — Natarajan, G. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · ipcn-api-dl — Baltisberger. 2006. IAPT/IOPB chromosome data 1. Taxon 55(2): 444.
CCDB · ipcn-api-dl — Astanova, S. B. 1981. Chromosome numbers of Leguminosae of flora in Tajikistan. Dokl. Akad. Nauk Tadziksk. SSR. 24: 61–63. (In Russian).
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).
CCDB · ipcn-api-dl — Slavĭk, B., V. Jarolĭmovă & J. Chrtek. 1993. Chromosome counts of some plants from Cyprus. Candollea 48(1): 221–230.
CCDB · book-ipcn72 — KUZMANOV, B.A., & G. STANCEV. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — ANGULO, M.D., A.M. SANCHEZ DE RIVERA, & F. GONZALEZ-BERNALDEZ. 1971. Estudios cromosomicos en el genera Trifolium.-V Bal. Soc. Brat. 45 (ser. 2): 253-268.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
+50 more references
2n 161×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Semerenko, L. V. & I. V. Shvets. (1989). Karyologicheskoe isuchenie bobovykh (Fabaceae) Belorusii. In Tesizy II Symp. Plant Karyology. : 66-68. Novosibirsk.
n 77×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cannon, 2015 +1
CCDB · ipcn-api-dl — Taylor, N. L., J. M. Gillett & N. Giri. 1983. Morphological observations and chromosome numbers in Trifolium L. section Chronosemium Ser. Cytologia 48: 671–677.
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · book-ipcn67-71 — ANGULO, M.D., A.M. SANCHEZ DE RIVERA, & F. GONZALEZ-BERNALDEZ. 1971. Estudios cromosomicos en el genera Trifolium.-V Bal. Soc. Brat. 45 (ser. 2): 253-268.
CCDB · Cannon, 2015 — Slavik, B., V. Jarolimova & J. Chrtek, 1993
CCDB · CromoCat 2015 — Humphries, C. J., Murray, B. G., Bocquet, G. & Vasudevan, K. N. (1978). Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131(4): 391-404.
CCDB · CromoCat 2015 — Taylor, N. L., J. M. Gillet & N. Giri. (1983). Morphological observations and chromosome numbers in Trifolium L. section Chronosemium Ser. Cytologia 48: 671-677.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1971). Estudios cromosómicos en el género Trifolium. V. Bol. Soc. Brot. 45: 253-267.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.988 ↗
08Occurrence & distribution
Record type307 001 records
Wild obs. + sensor291 464
Museum / vouchered13 237
Cultivated / captive549
Other1 751
Origin
Native18 836
Introduced7 890
Range
Area of Occupancy AOO431 616 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 66 279≤1 km 37 641≤10 km 132 821>10 km 2 391
239 132 georeferenced · 52 332 without coordinates
Open the mapobservation + sensor291 464
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 960≤1 km 2 090≤10 km 2 922>10 km 419
6 391 georeferenced · 6 846 without coordinates
Open the institutions mapphysical evidence13 237
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy1% within 1 km
≤1 km 1≤10 km 89>10 km 49
139 georeferenced · 410 without coordinates
Open the mapnot free-living549
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions213 of 402 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 339 |
| Berlin, DE | 835 |
| LDlocation not on record | 808 |
| BIO-UNIPIlocation not on record | 673 |
| Moscow State Universitylocation not on record | 315 |
| BFLlocation not on record | 314 |
| Adelaide, AU | 297 |
| MeiseBGlocation not on record | 276 |
| Helsinki, FI | 245 |
| Olocation not on record | 196 |
| Oskarshamn, SE | 185 |
| Philadelphia, US | 174 |
| SLU Artdatabankenlocation not on record | 167 |
| MAlocation not on record | 165 |
| Museo Entomologico de Leonlocation not on record | 124 |
| Wuzhou, CN | 121 |
| Chongqing Museumlocation not on record | 120 |
| BRNUlocation not on record | 119 |
| Badajoz, ES | 117 |
| CICYTEXlocation not on record | 113 |
| ISAlocation not on record | 113 |
| València, ES | 105 |
| BClocation not on record | 104 |
| KMNlocation not on record | 99 |
| Mount Annan, AU | 98 |
| Wlocation not on record | 97 |
| BDBClocation not on record | 95 |
| Uniwersytet Warszawskilocation not on record | 90 |
| Adam Mickiewicz University in Poznańlocation not on record | 88 |
| Salzburg, AT | 86 |
| Bloomington, US | 86 |
| Görlitz, DE | 81 |
| Entomological Society of Latvialocation not on record | 79 |
| Jena Microbial Resource Collectionlocation not on record | 78 |
| Saint Louis, US | 61 |
| College Park, US | 61 |
| Madison, US | 61 |
| Provincia di Livornolocation not on record | 61 |
| Christchurch, NZ | 60 |
| Williamsburg, US | 58 |
| Hobart, AU | 57 |
| St. Paul, US | 57 |
| Turku, FI | 57 |
| Nagano City, JP | 55 |
| Vitoria, ES | 55 |
| Pamplona, ES | 54 |
| University of Stellenboschlocation not on record | 54 |
| Bronx, US | 53 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 52 |
| Córdoba, ES | 50 |
| College of the Atlantic, Museumlocation not on record | 50 |
| Acadia Universitylocation not on record | 49 |
| Bangkok, TH | 48 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 47 |
| Bergen, NO | 47 |
| CJBGlocation not on record | 47 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 46 |
| Kensington, AU | 46 |
| Saint John, CA | 45 |
| Tartu, EE | 43 |
| Oulu, FI | 43 |
| Bern, CH | 43 |
| Barcelona, ES | 42 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 40 |
| South Kensington, GB | 39 |
| WTUlocation not on record | 39 |
| TUR-Alocation not on record | 38 |
| Chiba, JP | 38 |
| Madrid, ES | 36 |
| Odawara, JP | 36 |
| Salamanca, ES | 36 |
| San Sebastián, ES | 35 |
| Trondheim, NO | 34 |
| Tuscaloosa, US | 32 |
| University of New Hampshirelocation not on record | 31 |
| Canberra, AU | 31 |
| Mlocation not on record | 31 |
| Jackson, US | 31 |
| Tampa, US | 31 |
| Sevilla, ES | 31 |
| Auckland, NZ | 29 |
| UIBlocation not on record | 28 |
| Canadian Department of Agriculturelocation not on record | 28 |
| Emporia, US | 27 |
| Fort Worth, US | 27 |
| Corvallis, US | 27 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 27 |
| Granada, ES | 27 |
| Philadelphia, US | 27 |
| Burlington, US | 27 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 26 |
| Pittsburg, US | 25 |
| UGentlocation not on record | 25 |
| GJOlocation not on record | 24 |
| Santiago de Compostela, ES | 23 |
| Uppsala, SE | 22 |
| Kawasaki Shi Tama Ku, JP | 22 |
| Chapel Hill, US | 21 |
| Porto Alegre, BR | 21 |
| Allentown, US | 21 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 21 |
| Riverside, US | 20 |
| GBR016location not on record | 20 |
| Frankfurt am Main | 20 |
| Knoxville, US | 20 |
| Kew, GB | 20 |
| Minia, EG | 19 |
| US | 19 |
| Montréal, CA | 18 |
| Zürich, CH | 18 |
| Davis, US | 18 |
| Tsukuba, JP | 18 |
| BAYLUlocation not on record | 18 |
| Stockholm, SE | 17 |
| Green Bay, US | 17 |
| Wellington, NZ | 16 |
| Ann Arbor, US | 16 |
| AUAlocation not on record | 15 |
| Phyletisches Museum Jenalocation not on record | 15 |
| Fayetteville, US | 15 |
| Sanda, JP | 15 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 15 |
| Rishon Le Zion, IL | 15 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 14 |
| Valdosta State Universitylocation not on record | 14 |
| Paris, FR | 14 |
| Uniwersytet Śląski w Katowicachlocation not on record | 14 |
| Columbia, US | 14 |
| Pullman, US | 13 |
| Morgantown, US | 13 |
| Pamplona, ES | 13 |
| Dresden, DE | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| Shinshu Universitylocation not on record | 12 |
| Museo Achille Folettolocation not on record | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| San Luis Obispo, US | 11 |
| Coimbra, PT | 11 |
| Alicante, ES | 11 |
| Bando, JP | 11 |
| GAlocation not on record | 11 |
| Kochi, JP | 11 |
| CZE096location not on record | 10 |
| Jyväskylä, FI | 10 |
| NSMKlocation not on record | 10 |
| National Institute of Biological Resourceslocation not on record | 10 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 10 |
| Johnson City, US | 9 |
| Fairfax, US | 9 |
| Little Rock, US | 9 |
| Norfolk, US | 9 |
| GB | 9 |
| Karlsruhe, DE | 9 |
| ASUlocation not on record | 9 |
| Nijmegen, NL | 9 |
| Jaén, ES | 9 |
| University of Tennessee at Chattanoogalocation not on record | 9 |
| Frauenfeld, CH | 9 |
| Clemson, US | 8 |
| Victoria, CA | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| New Brunswick, US | 8 |
| Tula State Universitylocation not on record | 8 |
| Tacoma, US | 8 |
| Zürich, CH | 8 |
| Turlock, US | 7 |
| Moscow, US | 7 |
| NMBU:MINAlocation not on record | 7 |
| Fulda, DE | 7 |
| Portland, US | 7 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| Claremont, US | 7 |
| Toronto, CA | 7 |
| BG-NMNHSlocation not on record | 7 |
| SZUlocation not on record | 7 |
| Austin, US | 7 |
| Santa Barbara, US | 7 |
| Vancouver, CA | 6 |
| NSW Office of Environment and Heritagelocation not on record | 6 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 6 |
| Boise, US | 6 |
| ZRC-SAZUlocation not on record | 6 |
| Chicago, US | 6 |
| KIRMlocation not on record | 6 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 6 |
| IWEP FEB RASlocation not on record | 6 |
| EL PASO, US | 6 |
| Sagamihara, JP | 6 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 6 |
| Bourges, FR | 6 |
| Institute of the biological problems of the North FEB RASlocation not on record | 6 |
| Porvoo, FI | 5 |
| Fukushima Universitylocation not on record | 5 |
| Santa Cruz, US | 5 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 5 |
| Kuopio, FI | 5 |
| Osaka, JP | 5 |
| TROMlocation not on record | 5 |
| Mississippi State, US | 5 |
| Arcata, US | 5 |
| LfUlocation not on record | 5 |
| Lord Fairfax Community Collegelocation not on record | 5 |
| Richmond, US | 5 |
| PRClocation not on record | 5 |
| GZUlocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Dover, US | 5 |
| Millersville, US | 5 |
| China Agricultural Universitylocation not on record | 5 |
| Philadelphia, US | 4 |
| PrivatHerblocation not on record | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Durham, US | 4 |
| San Angelo, US | 4 |
| Flagstaff, US | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| San Diego, US | 4 |
| Chadron, US | 4 |
| Black Rock Forest Consortiumlocation not on record | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| Tilburg, NL | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Parkville, AU | 4 |
| DBF-NHMDlocation not on record | 4 |
| Namur, BE | 4 |
| JP | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Tennessee Technological Universitylocation not on record | 4 |
| Lincoln, US | 4 |
| Universidad de Caldas (UCaldas)location not on record | 4 |
| SVN019location not on record | 4 |
| UChlocation not on record | 4 |
| Tall Timbers Research Stationlocation not on record | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| Jefferson City, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Porrentruy, CH | 3 |
| CASlocation not on record | 3 |
| Miami, US | 3 |
| Palmerston North, NZ | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| BSBIlocation not on record | 3 |
| McWane Science Centerlocation not on record | 3 |
| Voronezh State Universitylocation not on record | 3 |
| Palmerston, AU | 3 |
| West Virginia Wesleyan Collegelocation not on record | 3 |
| H-Schuhwlocation not on record | 3 |
| Joondalup, AU | 3 |
| Kushiro City Museumlocation not on record | 3 |
| Glarus, CH | 3 |
| Wollongong, AU | 3 |
| Rotorua, NZ | 3 |
| Armidale, AU | 3 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 3 |
| US | 3 |
| Henry Brockhouse Collectionlocation not on record | 3 |
| WAGlocation not on record | 3 |
| AZE015location not on record | 3 |
| Kirksville, US | 3 |
| POL003location not on record | 3 |
| Toyama, JP | 3 |
| Akita Prefectural Museumlocation not on record | 2 |
| Bozeman, US | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| Kagoshima, JP | 2 |
| Mount Berry, US | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Springfield, US | 2 |
| OLAlocation not on record | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Hudson, US | 2 |
| JBSlocation not on record | 2 |
| Denton, US | 2 |
| Albuquerque, US | 2 |
| Nishihara, JP | 2 |
| Tallinn, EE | 2 |
| Chicago, US | 2 |
| Sion, CH | 2 |
| ROM007location not on record | 2 |
| HUN003location not on record | 2 |
| Podgorica, ME | 2 |
| Xiamen, CN | 2 |
| Henderson, US | 2 |
| Sant Julià de Lòria, AD | 2 |
| Göteborg, SE | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Hiratsuka City Museumlocation not on record | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| nbflocation not on record | 2 |
| Whitehorse, CA | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Taipei, TW | 2 |
| Beijing, CN | 2 |
| Provo, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| La Trobe Universitylocation not on record | 2 |
| Macomb, US | 2 |
| Whitewater, US | 2 |
| Blumenau, BR | 2 |
| BGPAlocation not on record | 2 |
| QVMAGlocation not on record | 2 |
| LGlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| Valparaíso, CL | 2 |
| Québec, CA | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| EAlocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| Sendai, JP | 2 |
| Nishihara, JP | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| New Haven, US | 2 |
| Conway, US | 2 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Batemans Bay, AU | 1 |
| Banyoles, ES | 1 |
| Clocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| Long Beach, US | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Addis Ababa, ET | 1 |
| Museum of the Rockieslocation not on record | 1 |
| CJBNlocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Phoenix, US | 1 |
| University of Patraslocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Angwin, US | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| SVK001location not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Conway, US | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Dekalb, US | 1 |
| Northridge, US | 1 |
| Tomioka, JP | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| Fribourg, CH | 1 |
| San Jose, US | 1 |
| Blacksburg, US | 1 |
| UMKClocation not on record | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Russellville, US | 1 |
| Lausanne, CH | 1 |
| Fredericksburg, US | 1 |
| *unvoucheredlocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Brown Universitylocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Córdoba, AR | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| Bratislava, SK | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| FLADlocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Otaru, JP | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Tokushima, JP | 1 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| DSMlocation not on record | 1 |
| Haramaya Universitylocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| National Range Agencylocation not on record | 1 |
| Lubbock, US | 1 |
| KURAlocation not on record | 1 |
| Durham, US | 1 |
| Monastir, TN | 1 |
| Elikins, US | 1 |
| San Isidro, AR | 1 |
| Asheville, US | 1 |
| Smithsonian Institutionlocation not on record | 1 |
| Plocation not on record | 1 |
| Pretoria, ZA | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| San Francisco, US | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Edmonton, CA | 1 |
| München, DE | 1 |
| LUXEMBOURG, LU | 1 |
| Mohonk Preservelocation not on record | 1 |
| Portland, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Forssa, FI | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
402 institutions · 12 084 of 13 237 vouchered records shown · 857 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA64 detections
Where the DNA of Trifolium campestre was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found64
Studies independent surveys3
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 64 detections have coordinates
Open the map9 countries0
Grass field with Alfalfa, Canda Thistle.Disturbed areas around edges of quarry.Along road shoulder at edge of pavement, oft…in sandy grasslandIn waste ground in ski club parking lot.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.5 °C 12.5–17.4
Seasonal swing summer↔winter16.0 °C
Max temp (day)15.9 °C 15.0–21.4
Min temp (night)10.2 °C 9.20–13.6
Precipitation91.3 mm/mo 62.1–162
Air humidity62.5 % 56.4–63.2
Moisture balance23.6 mm/mo -48.2–53.3
Vapour deficit576 Pa 543–836
Wind speed4.20 m/s 1.60–4.90
Cloud cover40.8 % 38.0–51.5
CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.