Trifolium bifidum

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records773

Data sources11

Biological traits19

DNA specimens1

eDNA detections2

Sources11 archives

Databases and archives Trifolium bifidum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility773 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF773 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trifolium bifidum is a species of clover known by the common names notchleaf clover and pinole clover. It is native to the western United States from Washington to California, where it grows in many types of habitat. It is an annual herb spreading or growing erect in form. It is lightly hairy to hairless in texture. The leaves are made up of oval leaflets 1 to 2 centimeters long, usually with notches in the tips. The inflorescence is a head of flowers up to 1.5 centimeters wide. Each flower has a calyx of sepals that narrow to bristles covered in long hairs. The flower corolla is yellowish, pinkish, or purple and under a centimeter long. The flowers droop on the head as they age.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.09 mg

Seed mass max1.17 mg

Seed mass min1.01 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio11.19 g/g

Leaf c433 mg/g

Leaf dry-matter content (LDMC)211 mg/g

Leaf n38.7 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)31.35 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium bifidum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ624197.1 ↗730 bpUSA

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACACGTGAATCGGTTTGAACACATAAGGTTGG …

Trifolium bifidum var. decipiens bio-material USDA NPGS PI 593285 from USA small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trifolium bifidum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · book-ipcn65 · CCDB · book-fedorov

CCDB · book-ipcn65 — Mosquin & G. 1965

CCDB · book-fedorov — Mos!Juin, Gillett 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.992 ↗

08Occurrence & distribution

Record type773 records

Wild obs. + sensor590

Museum / vouchered183

Range

Area of Occupancy AOO1 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 365≤1 km 43≤10 km 7>10 km 24

439 georeferenced · 151 without coordinates

Open the mapobservation + sensor590

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 14≤1 km 49≤10 km 21>10 km 3

87 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence183

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	50
Arcata, US	19
San Luis Obispo, US	16
Angwin, US	14
Santa Cruz, US	9
Claremont, US	9
Canadian Department of Agriculturelocation not on record	7
LDlocation not on record	5
Riverside, US	5
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	4
Corvallis, US	4
CASlocation not on record	4
Pullman, US	4
Bloomington, US	3
Wuzhou, CN	3
Tacoma, US	2
Bronx, US	2
Istituto Agrario Castelnuovolocation not on record	2
Portland, US	2
Mississippi State, US	1
Kew, GB	1
Moscow, US	1
Boise, US	1
WTUlocation not on record	1
Logan, US	1
University of Stellenboschlocation not on record	1
Long Beach, US	1
San Jose, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
US	1
San Francisco, US	1
Mexico City, MX	1
Bangkok, TH	1
EL PASO, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
ASUlocation not on record	1

36 institutions · 181 of 183 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Trifolium bifidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)