Trifolium aureum
Pollich · speciesAt a glance
Occurrence records43 711
Data sources13
Biological traits57
DNA specimens43
eDNA detections18
Sources13 archives
Databases and archives Trifolium aureum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility43 711 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics43 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources57 traits
Chemical compositionLOTUS · NPASS96 compounds
Occurrence & distributionGBIF43 711 records
Environmental DNA1 datasets · 3 countries18 detections
DNA & barcodingBOLD · NCBI43 specimens
Genome at a glanceCCDB · GoaT370 Mbp
01Narrative
Trifolium aureum, le trèfle doré, est une espèce de plantes à fleurs de la famille des Fabaceae originaire d'une grande partie de l'Eurasie. Le trèfle doré est une petite plante bisannuelle herbacée pouvant atteindre 10-30 cm de haut. Comme tous les trèfles, il a des feuilles composées divisées en trois folioles sessiles, chaque foliole mesure 15-25 mm de long et 6-9 mm de large. Ses fleurs jaunes sont disposées en petites inflorescences rondes allongées de 12-20 mm de diamètre, situé à l'extrémité de la tige. Chaque fleur individuelle est décombante. En vieillissant, les fleurs deviennent brunes et ressemblent à du papier. Le fruit est une gousse contenant généralement deux graines.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology17
Fruit length2 mm
Leaf length12.5 mm
Leaf length max24 mm
Leaf mass12.07 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 412 mm² · GIFT: 413 mm²
Leaf width4.5 mm
Plant height0.335 m
⚠ sources differ — GIFT: 0.335 m · LEDA: 0.3 m · TRY: 0.325 m
Plant height generative0.353 m
Plant height max0.4 m
Plant height min0.15 m
Seed length1.19 mm
⚠ sources differ — TRY: 1.19 mm · AusTraits: 1.5 mm
Seed mass0.296 mg
⚠ sources differ — TRY: 0.296 mg · LEDA: 0.44 mg · GIFT: 0.347 mg
Seed mass max0.3 mg
Seed mass min0.21 mg
Seed width1.5 mm
Seed width max1.5 mm
Seed width min1.5 mm
Life cycle & reproduction17
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flower colourbrown
Flower length max6 mm
Flower length min4 mm
Flowering endAug
Flowering startJun
Life formannual or biennial
Life spanannual/biennial
⚠ sources differ — TRY: annual/biennial · AusTraits: annual biennial · GIFT: annual
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number2 060
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 000 m
Elevation min400 m
Epiphyteterrestrial
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
Habitat GIFTcrop fields, forest edges, meadows: dry, roadsides, sand, shores
Leaf compoundnesscompound
Leaf formoblong
Leaf shapeelliptical narrowly_obovate oblong rhomboidal
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)208 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)45.25 mm²/mg
⚠ sources differ — TRY: 45.25 mm²/mg · LEDA: 37.99 mm²/mg · GIFT: 38.33 mm²/mg
Other traits2
Diaspore typefruit with appendage
Shoot orientationerect
03Chemical composition96 compounds
Compounds documented for Trifolium aureum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Flavonols13
Isoflavones4
Cinnamic acids and derivatives4
Stigmastane steroids4
Furofuranoid lignans3
Documented compounds96 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Pinoresinol | present | NPASS | |
| (+)-Ursolic Acid | present | NPASS | |
| (1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid | present | NPASS | |
| (2R)-3-[[(E)-9-Octadecenoyl]oxy]-1,2-propanediol | present | NPASS | |
| (2R,3S,4S,5R,6R)-2-methyl-6-phenoxyoxane-3,4,5-triol | present | NPASS | |
| (3R)-5-[[(2R,3S,4S,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxochromen-3-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3-hydroxy-3-methyl-5-oxopentanoic acid | present | NPASS | |
| (3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol | present | NPASS | |
| (3R,8R,9R,10S,13R,14R,17S)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | NPASS | |
| (4-Methoxybenzyl)thiocarbamic acid 4'-O-(tri-O-acetyl-alpha-L-rhamnopyranoside) | present | NPASS | |
| (Z)-N-[(4-hydroxyphenyl)methyl]ethoxycarbothioamide 4'-(tri-acetylrhamnoside) | present | NPASS |
05DNA & barcoding43 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium aureum has left across the world's sequence archives.
At a glance
DNA specimens43
Marker genes11
GenBank sequences10
eDNA detections18
Countries6
The DNA barcodea real sequence read deposited for this species
AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATACAGTCCAACACGTGAACAAGTTTGAACACATAAAGGTTG …
Trifolium aureum bio-material MFFGC AZ2771 from Armenia small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL2★rbcLa★trnL-F★ITS8★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Trifolium aureum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size369 684 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium aureum0.37 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–162n range14median14mode29records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1419×CCDB · slov-fl · CCDB · iber-fl · CCDB · poland +7
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).
CCDB · ipcn-api-dl — Stepanov, N. V. & E. N. Muratova. 1995. Chromosome numbers of some taxa of higher plants of Krasnoyarsk territory. Bot. Žhurn. (Moscow & Leningrad) 80(6): 114–116.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Semerenko, L. V. & I. V. Shvets. 1989. Karyologicheskoe isuchenie bobovykh (Fabaceae) Belorussii. Pp. 66--68 in Tesizy II Symp. Plant Karyology.
CCDB · book-ipcn75-78 — Nielsen 1975
CCDB · book-ipcn73-74 — KOZUHAROV, S. I. , A. V. PETROVA, & T. MARKOV A. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-fedorov — LOve A., LOve D. 1956b
CCDB · book-atlas-flowering-plants — Wulff"1939b
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1974c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 377-378.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Petrova, A. & S. Kozuharov. (1982). Cytotaxonomic study of genus Trifolium L. in Bulgaria. I. II. Phytology 19: 3-23; 20: 20-41.
CCDB · CromoCat 2015 — Stepanov, N. V. & E. N. Muratova. (1995). Chromosome numbers of some taxa of higher plants of Krasnoyarsk territory. Bot. Žurn. 80(6): 114-116.
2n 1610×GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea · CCDB · ipcn-api-dl +3
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · fl-europaea — Lovkvist, 1962
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — Giri, N., N. L. Taylor & G. B. Collins. 1981. Chromosome numbers in some Trifolium species with a karyotype for T. physodes. Canad. J. Genet. Cytol. 23: 621–626.
CCDB · book-ipcn72 — KUZMANOV, B.A., & G. STANCEV. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · kew — Vižintin L, Javornik B, Bohanec B. 2006. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Science 170: 859-866.
CCDB · CromoCat 2015 — Kuzmanov, B. A. & Stancev, G. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVIII]. Taxon 21(5/6): 681.
CCDB · CromoCat 2015 — Krasnikov, A. A. & Schaulo, D. N. (1990). Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II Botani?eskij Žurnal (Moscow & Leningrad) 75: 118-120
CCDB · CromoCat 2015 — Kuzmanov, B. (1978). Citotaxonomicno izsledvane na balgarski bobovi rastcnija. In: Evoljuclja na cvetnite rastenija i florogenez 1: 11-71.
CCDB · CromoCat 2015 — Petrova, A. & S. Kozuharov. (1982). Cytotaxonomic study of genus Trifolium L. in Bulgaria. I. II. Phytology 19: 3-23; 20: 20-41.
n 82×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Giri, N., N. L. Taylor & G. B. Collins. 1981. Chromosome numbers in some Trifolium species with a karyotype for T. physodes. Canad. J. Genet. Cytol. 23: 621–626.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 71×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.984 ↗
08Occurrence & distribution
Record type43 711 records
Wild obs. + sensor36 871
Museum / vouchered6 570
Cultivated / captive63
Other207
Origin
Native3
Introduced183
Range
Area of Occupancy AOO106 540 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy60% within 1 km
≤100 m 14 223≤1 km 4 202≤10 km 11 496>10 km 580
30 501 georeferenced · 6 370 without coordinates
Open the mapobservation + sensor36 871
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 519≤1 km 944≤10 km 1 728>10 km 1 094
4 285 georeferenced · 2 285 without coordinates
Open the institutions mapphysical evidence6 570
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy14% within 1 km
≤100 m 1≤1 km 2≤10 km 3>10 km 16
22 georeferenced · 41 without coordinates
Open the mapnot free-living63
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions123 of 219 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 887 |
| Olocation not on record | 555 |
| LDlocation not on record | 454 |
| Moscow State Universitylocation not on record | 399 |
| Uniwersytet Wrocławskilocation not on record | 397 |
| Chongqing Museumlocation not on record | 241 |
| SLU Artdatabankenlocation not on record | 165 |
| BFLlocation not on record | 158 |
| Kuopio, FI | 155 |
| Oskarshamn, SE | 152 |
| MeiseBGlocation not on record | 146 |
| Salzburg, AT | 113 |
| Madison, US | 102 |
| Oulu, FI | 83 |
| Zürich, CH | 77 |
| Jyväskylä, FI | 73 |
| Turku, FI | 72 |
| Görlitz, DE | 65 |
| Trondheim, NO | 61 |
| Tartu, EE | 61 |
| Saint John, CA | 60 |
| BRNUlocation not on record | 56 |
| Burlington, US | 50 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 48 |
| Zürich, CH | 46 |
| Berlin, DE | 44 |
| TUR-Alocation not on record | 44 |
| WTUlocation not on record | 42 |
| Allentown, US | 39 |
| Frankfurt am Main | 34 |
| University of Stellenboschlocation not on record | 34 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 33 |
| Ann Arbor, US | 33 |
| Provincia di Livornolocation not on record | 33 |
| St. Paul, US | 32 |
| Acadia Universitylocation not on record | 30 |
| Bern, CH | 29 |
| Pullman, US | 28 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 28 |
| Montréal, CA | 27 |
| Green Bay, US | 27 |
| Adam Mickiewicz University in Poznańlocation not on record | 26 |
| Missoula, US | 25 |
| GJOlocation not on record | 25 |
| Jena Microbial Resource Collectionlocation not on record | 23 |
| College Park, US | 22 |
| CJBGlocation not on record | 21 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 21 |
| Bergen, NO | 21 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 20 |
| BClocation not on record | 20 |
| Wlocation not on record | 20 |
| Bloomington, US | 20 |
| BDBClocation not on record | 19 |
| Tallinn, EE | 19 |
| KMNlocation not on record | 19 |
| Chapel Hill, US | 18 |
| Moscow, US | 17 |
| SZUlocation not on record | 17 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 17 |
| DBF-NHMDlocation not on record | 16 |
| Porvoo, FI | 16 |
| Tula State Universitylocation not on record | 16 |
| Museo Entomologico de Leonlocation not on record | 16 |
| Dresden, DE | 16 |
| Nagano City, JP | 15 |
| Porrentruy, CH | 15 |
| Christchurch, NZ | 14 |
| Vancouver, CA | 13 |
| Toronto, CA | 13 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 12 |
| Uppsala, SE | 12 |
| Victoria, CA | 11 |
| IDElocation not on record | 11 |
| Mlocation not on record | 11 |
| Uniwersytet Warszawskilocation not on record | 9 |
| Université Lavallocation not on record | 9 |
| Bronx, US | 8 |
| Stockholm, SE | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Corvallis, US | 8 |
| NMBU:MINAlocation not on record | 8 |
| SVK001location not on record | 8 |
| Glarus, CH | 8 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| Fulda, DE | 7 |
| Brussel, BE | 7 |
| Barcelona, ES | 7 |
| Boise, US | 7 |
| Millersville, US | 7 |
| Bourges, FR | 6 |
| Mohonk Preservelocation not on record | 6 |
| Badajoz, ES | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Forssa, FI | 6 |
| Hobart, AU | 6 |
| CZE096location not on record | 6 |
| Philadelphia, US | 6 |
| MAlocation not on record | 6 |
| Philadelphia, US | 5 |
| Odawara, JP | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 5 |
| Wellington, NZ | 5 |
| Dekalb, US | 5 |
| Tsukuba, JP | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Philadelphia, US | 5 |
| University of New Hampshirelocation not on record | 5 |
| University of British Columbia, Herbariumlocation not on record | 5 |
| South Kensington, GB | 4 |
| TROMlocation not on record | 4 |
| Hudson, US | 4 |
| POL003location not on record | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Durham, US | 4 |
| BSBIlocation not on record | 4 |
| MKD001location not on record | 4 |
| PRClocation not on record | 4 |
| Provo, US | 4 |
| Wuzhou, CN | 3 |
| Oswego, US | 3 |
| Turlock, US | 3 |
| València, ES | 3 |
| Riverside, US | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Kushiro City Museumlocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Whitewater, US | 3 |
| University of Alberta Museumslocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| LfUlocation not on record | 3 |
| New Brunswick, US | 3 |
| ASUlocation not on record | 3 |
| Kew, GB | 3 |
| Ypsilanti, US | 2 |
| GZUlocation not on record | 2 |
| Norfolk, US | 2 |
| Smithsonian Institutionlocation not on record | 2 |
| Pittsburg, US | 2 |
| Edinburgh, GB | 2 |
| H-AkrKGlocation not on record | 2 |
| San Sebastián, ES | 2 |
| BAYLUlocation not on record | 2 |
| Rovaniemi, FI | 2 |
| Namur, BE | 2 |
| Logan, US | 2 |
| Mount Annan, AU | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Johnson City, US | 2 |
| PrivatHerblocation not on record | 2 |
| Sion, CH | 2 |
| Black Rock Forest Consortiumlocation not on record | 2 |
| Beijing, CN | 2 |
| Williamsburg, US | 2 |
| Xiamen, CN | 2 |
| No collectionlocation not on record | 2 |
| Otaru, JP | 2 |
| Columbia, US | 2 |
| Saint Louis, US | 2 |
| Québec, CA | 2 |
| Sant Julià de Lòria, AD | 2 |
| nbflocation not on record | 2 |
| ROM007location not on record | 1 |
| Dover, US | 1 |
| Jaén, ES | 1 |
| Anchorage, US | 1 |
| Vitoria, ES | 1 |
| Auckland, NZ | 1 |
| Paris, FR | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Brookings, US | 1 |
| Chicago, US | 1 |
| Canberra, AU | 1 |
| BG-NMNHSlocation not on record | 1 |
| San Isidro, AR | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Granada, ES | 1 |
| SWlocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| NoColllocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| FLADlocation not on record | 1 |
| Podgorica, ME | 1 |
| Chicago, US | 1 |
| Spearfish, US | 1 |
| Lausanne, CH | 1 |
| Dhaka, BD | 1 |
| Brisbane, AU | 1 |
| Fairfax, US | 1 |
| Phoenix, US | 1 |
| Fribourg, CH | 1 |
| Palmerston North, NZ | 1 |
| Smithfield, AU | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Salamanca, ES | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Frauenfeld, CH | 1 |
| Tromso University Museumlocation not on record | 1 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 1 |
| SEFlocation not on record | 1 |
| Taipei, TW | 1 |
| H-Schuhwlocation not on record | 1 |
| New Haven, US | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| AZE015location not on record | 1 |
| Garðabær, IS | 1 |
| Tomioka, JP | 1 |
| San Angelo, US | 1 |
| GB | 1 |
| Karlsruhe, DE | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
219 institutions · 6 232 of 6 570 vouchered records shown · 300 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA18 detections
Where the DNA of Trifolium aureum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found18
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 18 detections have coordinates
Open the map3 countries0
Managed boreal mixedwood standwoods on edge of marsh with geranium, abies,…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.1 °C 5.70–20.3
Seasonal swing summer↔winter26.2 °C
Max temp (day)20.9 °C 10.6–25.2
Min temp (night)9.40 °C 2.00–16.8
Precipitation79.8 mm/mo 55.9–104
Air humidity59.0 % 48.7–61.5
Moisture balance-48.2 mm/mo -78.9–16.5
Vapour deficit800 Pa 450–1,005
Wind speed2.70 m/s 1.80–4.70
Cloud cover39.9 % 32.2–50.3
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.