Trifolium arvense
speciesAt a glance
Occurrence records249 480
Data sources13
Biological traits75
DNA specimens57
eDNA detections75
Sources13 archives
Databases and archives Trifolium arvense's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility249 480 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI75 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics57 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources75 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF249 480 records
Environmental DNA3 datasets · 11 countries75 detections
DNA & barcodingBOLD · NCBI57 specimens
Genome at a glanceCCDB · GIFT · GoaT469 Mbp
01Narrative
Trèfle Pied-de-lièvre ou Pied-de-lièvre est une espèce de plantes à fleurs de l'ordre des Fabales et à la famille des Fabacées. On peut aussi l'appeler Trèfle des champs, mais il y a un risque de confusion avec Trifolium campestre, qui porte le même nom. C'est un trèfle commun dans toute l'Europe, en plaine ou en moyenne montagne. De couleur blanc rosâtre, son inflorescence est surtout caractérisée par les nombreux poils blancs soyeux dont sont munis les calices, beaucoup plus grands que les corolles. Ces poils, liés à la forme plus ou moins oblongue de l'inflorescence, sont à l'origine du nom vernaculaire.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology29
Fruit length1.25 mm
⚠ sources differ — AusTraits: 1.25 mm · GIFT: 2 mm
Fruit width2 mm
Inflorescence length max3.2 cm
Inflorescence length min0.6 cm
Leaf length20 mm
Leaf length max27 mm
Leaf length min10 mm
Leaf mass4.5 mg
⚠ sources differ — AusTraits: 4.5 mg · LEDA: 13.13 mg
Leaf mass per area37.81 g/m2
Leaf size27.2 mm²
⚠ sources differ — TRY: 27.2 mm² · AusTraits: 114 mm² · LEDA: 236 mm² · GIFT: 233 mm²
Leaf width17 mm
Leaf width max7 mm
Leaf width min2 mm
Plant height0.148 m
⚠ sources differ — GIFT: 0.148 m · AusTraits: 0.38 m · LEDA: 0.15 m · TRY: 0.175 m
Plant height generative0.145 m
Plant height max0.5 m
Plant height min0.05 m
Seed length1.11 mm
⚠ sources differ — TRY: 1.11 mm · GIFT: 0.8 mm
Seed length max1 mm
Seed length min0.8 mm
Seed mass0.39 mg
⚠ sources differ — TRY: 0.39 mg · AusTraits: 1.51 mg · LEDA: 0.302 mg · GIFT: 0.391 mg
Seed mass max1.32 mg
Seed mass min0.27 mg
Seed volume0.21 mm³
Seed volume max0.21 mm³
Seed volume min0.21 mm³
Seed width1 mm
Seed width max1 mm
Seed width min1 mm
Life cycle & reproduction18
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — LEDA: chamaechor · GIFT: zoochorous
Flower colourpink
Flowering endAug
Flowering startMay
Flowering timennnnnnnnyyyy
Life formannual or biennial
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number268
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
Habitat GIFTcrop fields, meadows: dry, mountains, sand, stony places
Leaf compoundnesscompound
Leaf shapenarrowly_elliptical narrowly_oblong
Mycorrhiza type0.00000000151
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio18.71 g/g
Leaf c478 mg/g
Leaf dry-matter content (LDMC)387 mg/g
⚠ sources differ — TRY: 387 mg/g · LEDA: 291 mg/g
Leaf n26.03 mg/g
Leaf p1.01 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)17.83 mm²/mg
⚠ sources differ — TRY: 17.83 mm²/mg · LEDA: 18.9 mm²/mg · GIFT: 18.21 mm²/mg
Other traits3
Diaspore typeone-seeded generative dispersule
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition7 compounds
Compounds documented for Trifolium arvense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Isoflavones4
Flavonols2
Isoflavanones1
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Arvensan | present | LOTUS | |
| Biochanin A | present | LOTUS | |
| Daidzein | present | LOTUS | |
| Formononetin | present | LOTUS | |
| Genistein | present | LOTUS | |
| Hyperin | present | LOTUS | |
| Isoquercitin | present | LOTUS |
05DNA & barcoding57 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium arvense has left across the world's sequence archives.
At a glance
DNA specimens57
Marker genes9
GenBank sequences10
eDNA detections75
Countries11
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATCGAAGCCTCTTG …
Trifolium arvense voucher PLT.0218 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL2★rbcLa★trnL-F★ITS7★ITS1★ITS2cp-trnL-intron
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Trifolium arvense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size469 440 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium arvense0.47 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–162n range14median14mode104records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 14102×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +22
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Holub J., Měsíček J. & Javůrková V., 1972: Annotated chromosome counts of Czechoslovak plants (31–60) (Materials for "Flóra ČSSR"– 3). - Folia Geobot. Phytotax. 7/2: 167-202.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · iber-fl — Estudios cariohistolgicos en el gnero Trifolium. Angulo Carpio, M. D., M. C. de Figueras & A. M. Snchez de Rivera.Bol. Soc. Brot. ser. 253(2): 877-885(1981).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VI Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Lagascalia2(1): 3-13(1972).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VII Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Gent. Ibr.24: 305-324(1972).
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2985
CCDB · fl-europaea — BOcher & Larsen,
CCDB · poland — Pogan E., Izmai?ow R. et al. 1983. Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov. Ser. Bot. 25, 57-77.
CCDB · mediterranean
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982a. Cytotaxonomic study of Trifolium L.: Bulgaria II. Fitologija 20: 20–40. (In Bulgarian).
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Angulo, M. D., M. C. D. Figueras & A. M. S. Rivera. 1981. Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 885–887.
CCDB · ipcn-api-dl — Pogan, E. 1983. Further studies in chromosome numbers of Polish angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57–77.
CCDB · ipcn-api-dl — Afzal-Raf;auu, Z., J. Vianot, M. Ramade & M. P. Bourreil. 1985. Analyses des charactères caryologiques et écologiques de quelques taxons dans les massifs du Lubéron, de Lure et du Mont-Ventoux. Rev. Cytol. Biol. Veg. Bot. 8: 33–62.
CCDB · ipcn-api-dl — Sokolovskaya, A. P., N. S. Probatova & E. G. Rudyka. 1989. Chromosome numbers in some species of the flora of the Soviet far east from the families Actinidiaceae, Aristolochiaceae, Fabaceae, Ranunculaceae, Saxifragaceae. Bot. Žhurn. (Moscow & Leningrad) 74: 268–271.
CCDB · ipcn-api-dl — Semerenko, L. V. 1989. Chromosome numbers in some members of the families Asteraceae, Fabaceae, Orchidaceae and Poaceae from the Berezinsky Biosphere Reservation (Byelorussia) flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1671–1673.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Baltisberger, M. & W. Huber. 1993. IOPB chromosome data 5. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 20: 4–6.
CCDB · ipcn-api-dl — Badr, A. 1995. Electrophoretic studies of seed proteins in relation to chromosomal criteria and the relationships of some taxa of Trifolium. Taxon 44: 183–191.
CCDB · ipcn-api-dl — Baltisberger, M. & E. Baltisberger. 1995. Cytological data of Albanian plants. Candollea 50(2): 457–493.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Issolah, R. & A. Abdelguerfi. 1999. Chromosome numbers within some spontaneous populations of 10 Trifolium species in Algeria. Caryologia 52: 151–154.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · book-ipcn72 — ANGULO, M.D., A.M. SANCHEZ DE RIVERA, & F. GONZALEZ-BERNALDEZ. 1972. Estudios cromosomicos en el genera Trifolium. VI. Lagascalia 2: 3-13.
CCDB · book-ipcn72 — HOLUB, J., J. MESICEK, & v. JAVURKOVA. 1972. Annotated chromo- some counts of Czechoslovak plants (31-60). (Materials for a Flora CSSR-3) Folia Geob. Phyto. (Czech. l 7: 167-202.
CCDB · book-ipcn72 — KUZMANOV, B.A., & G. STANCEV. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
+58 more references
2n 162×CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · book-fedorov — Evans A. M. 1962
GIFT · GIFT (floras)
n 72×CCDB · Cannon, 2015 · CCDB · CromoCat 2015
CCDB · Cannon, 2015 — Angulo, M.D., M.C. De Figueras & A.M. Sanchez de Rivera., 1981
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.988 ↗
08Occurrence & distribution
Record type249 480 records
Wild obs. + sensor234 437
Museum / vouchered13 922
Cultivated / captive112
Other1 009
Origin
Native7 411
Introduced8 797
Range
Area of Occupancy AOO370 524 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 75 702≤1 km 29 160≤10 km 92 732>10 km 1 783
199 377 georeferenced · 35 060 without coordinates
Open the mapobservation + sensor234 437
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 1 004≤1 km 2 490≤10 km 4 185>10 km 1 161
8 840 georeferenced · 5 082 without coordinates
Open the institutions mapphysical evidence13 922
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 9>10 km 19
28 georeferenced · 84 without coordinates
Open the mapnot free-living112
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions195 of 361 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 682 |
| Helsinki, FI | 809 |
| LDlocation not on record | 648 |
| Moscow State Universitylocation not on record | 477 |
| Olocation not on record | 362 |
| Berlin, DE | 362 |
| Turku, FI | 235 |
| Oskarshamn, SE | 209 |
| Kuopio, FI | 203 |
| MeiseBGlocation not on record | 193 |
| Adelaide, AU | 185 |
| Uniwersytet Warszawskilocation not on record | 149 |
| KMNlocation not on record | 133 |
| Chongqing Museumlocation not on record | 132 |
| MAlocation not on record | 125 |
| SLU Artdatabankenlocation not on record | 121 |
| València, ES | 120 |
| Museo Entomologico de Leonlocation not on record | 116 |
| Adam Mickiewicz University in Poznańlocation not on record | 106 |
| Oulu, FI | 94 |
| Bronx, US | 93 |
| Christchurch, NZ | 89 |
| Tartu, EE | 87 |
| TUR-Alocation not on record | 82 |
| Madison, US | 81 |
| CICYTEXlocation not on record | 78 |
| BClocation not on record | 78 |
| Görlitz, DE | 74 |
| Badajoz, ES | 71 |
| Mount Annan, AU | 70 |
| BFLlocation not on record | 69 |
| Zürich, CH | 67 |
| Québec, CA | 67 |
| Trondheim, NO | 66 |
| BRNUlocation not on record | 64 |
| University of New Hampshirelocation not on record | 64 |
| BDBClocation not on record | 62 |
| Bangkok, TH | 62 |
| St. Paul, US | 62 |
| Tallinn, EE | 62 |
| Wlocation not on record | 61 |
| Entomological Society of Latvialocation not on record | 61 |
| BIO-UNIPIlocation not on record | 59 |
| Bergen, NO | 58 |
| CJBGlocation not on record | 56 |
| College Park, US | 55 |
| Williamsburg, US | 54 |
| Zürich, CH | 53 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 51 |
| Auckland, NZ | 51 |
| New Haven, US | 49 |
| Hobart, AU | 49 |
| WTUlocation not on record | 48 |
| Burlington, US | 47 |
| Corvallis, US | 46 |
| South Kensington, GB | 46 |
| University of Stellenboschlocation not on record | 44 |
| Uppsala, SE | 43 |
| Saint John, CA | 43 |
| Provincia di Livornolocation not on record | 42 |
| Vitoria, ES | 41 |
| Jyväskylä, FI | 41 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 39 |
| Jena Microbial Resource Collectionlocation not on record | 38 |
| Allentown, US | 38 |
| Pullman, US | 37 |
| Barcelona, ES | 37 |
| Bern, CH | 35 |
| Salamanca, ES | 33 |
| Ann Arbor, US | 33 |
| Granada, ES | 29 |
| Kensington, AU | 28 |
| Saint Louis, US | 27 |
| Kew, GB | 27 |
| Wellington, NZ | 27 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 26 |
| San Sebastián, ES | 24 |
| Voronezh State Universitylocation not on record | 24 |
| Fort Worth, US | 23 |
| Madrid, ES | 23 |
| Green Bay, US | 23 |
| Chapel Hill, US | 22 |
| Moscow, US | 22 |
| College of the Atlantic, Museumlocation not on record | 22 |
| Frankfurt am Main | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| Salzburg, AT | 21 |
| Jackson, US | 21 |
| Université Lavallocation not on record | 21 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 20 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 19 |
| Córdoba, ES | 18 |
| Wuzhou, CN | 18 |
| BAYLUlocation not on record | 18 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 18 |
| Canberra, AU | 18 |
| Natural History Museum Rotterdamlocation not on record | 18 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 17 |
| Santiago de Compostela, ES | 17 |
| Columbia, US | 16 |
| TROMlocation not on record | 16 |
| UGentlocation not on record | 15 |
| Minia, EG | 15 |
| Stockholm, SE | 15 |
| Uniwersytet Śląski w Katowicachlocation not on record | 14 |
| Dresden, DE | 14 |
| Porvoo, FI | 14 |
| Philadelphia, US | 14 |
| Uniwersytet Jagiellońskilocation not on record | 14 |
| Norfolk, US | 13 |
| Acadia Universitylocation not on record | 13 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 13 |
| GJOlocation not on record | 13 |
| NSW Office of Environment and Heritagelocation not on record | 12 |
| Montréal, CA | 12 |
| Tuscaloosa, US | 12 |
| Museo Achille Folettolocation not on record | 11 |
| Paris, FR | 11 |
| Canadian Department of Agriculturelocation not on record | 11 |
| PRClocation not on record | 11 |
| New Brunswick, US | 11 |
| Philadelphia, US | 11 |
| Millersville, US | 10 |
| CZE096location not on record | 10 |
| Rotorua, NZ | 10 |
| Keene State Universitylocation not on record | 10 |
| Knoxville, US | 10 |
| Valdosta State Universitylocation not on record | 10 |
| GAlocation not on record | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Tula State Universitylocation not on record | 10 |
| Portland, US | 10 |
| Phyletisches Museum Jenalocation not on record | 10 |
| Boise, US | 9 |
| Porrentruy, CH | 9 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 9 |
| Mlocation not on record | 9 |
| Tampa, US | 9 |
| University of Birminghamlocation not on record | 9 |
| Parkville, AU | 9 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 9 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 8 |
| Emporia, US | 8 |
| Fayetteville, US | 8 |
| SWlocation not on record | 8 |
| Mississippi State, US | 8 |
| Tilburg, NL | 8 |
| Sevilla, ES | 8 |
| Staten Island, US | 8 |
| Riverside, US | 8 |
| Provo, US | 8 |
| Vancouver, CA | 8 |
| Victoria, CA | 7 |
| Palmerston, AU | 7 |
| QVMAGlocation not on record | 7 |
| Austin, US | 7 |
| Davenport, US | 7 |
| Durham, US | 7 |
| Bourges, FR | 7 |
| Frauenfeld, CH | 7 |
| Lubbock, US | 7 |
| Little Rock, US | 7 |
| Washington, US | 7 |
| Dekalb, US | 7 |
| Alicante, ES | 6 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 6 |
| IDElocation not on record | 6 |
| McWane Science Centerlocation not on record | 6 |
| AUAlocation not on record | 6 |
| Clemson, US | 6 |
| Odawara, JP | 6 |
| UIBlocation not on record | 6 |
| GBR016location not on record | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Pamplona, ES | 6 |
| Toronto, CA | 6 |
| Uniwersytet Opolskilocation not on record | 6 |
| IWEP FEB RASlocation not on record | 5 |
| Pittsburg, US | 5 |
| Karlsruhe, DE | 5 |
| San Isidro, AR | 5 |
| University of Southern Mississippilocation not on record | 5 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 5 |
| Fairfax, US | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Nijmegen, NL | 4 |
| BSBIlocation not on record | 4 |
| Philadelphia, US | 4 |
| Beijing, CN | 4 |
| NMBU:MINAlocation not on record | 4 |
| BGBMlocation not on record | 4 |
| Smithfield, AU | 4 |
| Tsukuba, JP | 4 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 4 |
| Edinburgh, GB | 4 |
| San Angelo, US | 4 |
| Namur, BE | 4 |
| Missoula, US | 4 |
| Sion, CH | 4 |
| Flagstaff, US | 4 |
| Pamplona, ES | 4 |
| Institute of the biological problems of the North FEB RASlocation not on record | 4 |
| GB | 4 |
| Valparaiso, CL | 4 |
| Dover, US | 4 |
| Santa Barbara, US | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 4 |
| SZUlocation not on record | 3 |
| Ypsilanti, US | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| Rishon Le Zion, IL | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| ISAlocation not on record | 3 |
| Mohonk Preservelocation not on record | 3 |
| Wollongong, AU | 3 |
| Fulda, DE | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| LfUlocation not on record | 3 |
| H-Hohlalocation not on record | 3 |
| Chicago, US | 3 |
| EL PASO, US | 3 |
| Lausanne, CH | 3 |
| Kingston, US | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| DBF-NHMDlocation not on record | 3 |
| ROM007location not on record | 3 |
| Fukushima Universitylocation not on record | 3 |
| Jaén, ES | 3 |
| Armidale, AU | 3 |
| Arcata, US | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Bozeman, US | 3 |
| Davis, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Forssa, FI | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Monastir, TN | 2 |
| Córdoba, AR | 2 |
| KNFYlocation not on record | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Whitehorse, CA | 2 |
| Kushiro City Museumlocation not on record | 2 |
| Göteborg, SE | 2 |
| Santa Cruz, US | 2 |
| KNFHClocation not on record | 2 |
| GZUlocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| AZE015location not on record | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| OLAlocation not on record | 2 |
| Edmonton, CA | 2 |
| Claremont, US | 2 |
| La Trobe Universitylocation not on record | 2 |
| FLADlocation not on record | 2 |
| Chadron, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| H-Schuhwlocation not on record | 2 |
| US | 2 |
| Palmerston North, NZ | 2 |
| San Diego, US | 2 |
| Long Beach, US | 2 |
| Glarus, CH | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Hudson, US | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Miami, US | 2 |
| Otaru, JP | 2 |
| Chicago, US | 2 |
| Bend, US | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| Brisbane, AU | 2 |
| Springfield, US | 2 |
| CASlocation not on record | 2 |
| US | 2 |
| Angwin, US | 2 |
| UoB-IBlocation not on record | 2 |
| San Luis Obispo, US | 2 |
| Brock University (BU)location not on record | 2 |
| POL003location not on record | 2 |
| Aarhus, DK | 1 |
| ASUlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Sanda, JP | 1 |
| FLASlocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| LGlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Cambridge, US | 1 |
| Lincoln, US | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| WAGlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| LUXEMBOURG, LU | 1 |
| San Francisco, US | 1 |
| Pocatello, US | 1 |
| Taipei, TW | 1 |
| IPE-CSIClocation not on record | 1 |
| JP | 1 |
| UniKSlocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Denton, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Haramaya Universitylocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| National Range Agencylocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Taipei, TW | 1 |
| Boumlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Phoenix, US | 1 |
| HUN003location not on record | 1 |
| Columbus State Universitylocation not on record | 1 |
| NoColllocation not on record | 1 |
| Chicago, US | 1 |
| Chiba, JP | 1 |
| Conway, US | 1 |
| H-AkrKGlocation not on record | 1 |
| CIBIOlocation not on record | 1 |
| Due West, US | 1 |
| US | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Henderson, US | 1 |
| Fredericksburg, US | 1 |
| Xiamen, CN | 1 |
| sonstHerblocation not on record | 1 |
| nbflocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| KURAlocation not on record | 1 |
| Madrid, ES | 1 |
| Podgorica, ME | 1 |
| DULlocation not on record | 1 |
| Whitewater, US | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Salvador, BR | 1 |
| JBRJlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Ashland, US | 1 |
| Cheney, US | 1 |
| Tacoma, US | 1 |
| Walla Walla, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Durham, US | 1 |
| Bloomington, US | 1 |
| University of Lethbridgelocation not on record | 1 |
361 institutions · 12 051 of 13 922 vouchered records shown · 1 491 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA75 detections
Where the DNA of Trifolium arvense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found75
Studies independent surveys3
Countries11
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 75 detections have coordinates
Open the map11 countries0
Dry soil along paths in open oak woodland. s…Dry soil. sandroadsideIn compacted soil at edge of parking lot; as…Prairie
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.2 °C 12.5–19.1
Seasonal swing summer↔winter18.1 °C
Max temp (day)21.4 °C 15.0–24.9
Min temp (night)13.4 °C 9.20–13.7
Precipitation79.7 mm/mo 40.4–91.3
Air humidity60.5 % 54.0–62.6
Moisture balance-22.1 mm/mo -112–23.6
Vapour deficit776 Pa 543–1,024
Wind speed3.30 m/s 1.80–5.10
Cloud cover36.8 % 26.9–49.5
CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.