Trifolium angustifolium
speciesAt a glance
Occurrence records37 085
Data sources12
Biological traits61
DNA specimens18
eDNA detections9
Sources12 archives
Databases and archives Trifolium angustifolium's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility37 085 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics18 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources61 traits
Chemical compositionLOTUS3 compounds
Occurrence & distributionGBIF37 085 records
Environmental DNA1 datasets · 2 countries9 detections
DNA & barcodingBOLD · NCBI18 specimens
Genome at a glanceCCDB2n = 16
01Narrative
Le trèfle à feuilles étroites est une espèce de plantes à fleurs du genre Trifolium et de la famille des Fabacées. Il pousse à la fin du printemps, surtout dans les régions méditerranéennes, et se reconnaît facilement à son inflorescence allongée, semblable à un épi de graminée, et à ses petites fleurs roses.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology20
Fruit length3 mm
Inflorescence length max13 cm
Inflorescence length min2.5 cm
Leaf length40 mm
Leaf length max75 mm
Leaf length min30 mm
Leaf width3 mm
Leaf width max7 mm
Leaf width min2 mm
Plant height0.11 m
⚠ sources differ — GIFT: 0.11 m · AusTraits: 0.35 m · LEDA: 0.11 m · TRY: 0.22 m
Plant height generative0.281 m
Plant height max0.7 m
Plant height min0.1 m
Seed length2 mm
Seed mass1.76 mg
⚠ sources differ — TRY: 1.76 mg · AusTraits: 1.51 mg · LEDA: 1.31 mg · GIFT: 1.69 mg
Seed mass max3.68 mg
Seed mass min0.67 mg
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction16
Deciduousnessdeciduous
Dispersal typeanimal
Flower colourpink
Flower length max12 mm
Flower length min10 mm
Flowering endJul
Flowering startApr
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 750 m
Elevation min0 m
Epiphyteterrestrial
Fruit typelegume
Growth formherb
Habitat GIFTforest edges, mountains, shrubberies
Leaf compoundnesscompound
Leaf formelliptic
Leaf shapelanceolate linear
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio15.14 g/g
Leaf c450 mg/g
Leaf dry-matter content (LDMC)282 mg/g
Leaf n31.23 mg/g
Leaf p1.28 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)19.48 mm²/mg
⚠ sources differ — TRY: 19.48 mm²/mg · LEDA: 15.6 mm²/mg · GIFT: 18.65 mm²/mg
Other traits2
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition3 compounds
Compounds documented for Trifolium angustifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Pterocarpan3
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| Medicarpin | present | LOTUS |
05DNA & barcoding18 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium angustifolium has left across the world's sequence archives.
At a glance
DNA specimens18
Marker genes7
GenBank sequences10
eDNA detections9
Countries4
The DNA barcodea real sequence read deposited for this species
CGAAGCCTCTTGCCAATTTCCTAATGATAGGTATTGTGCAGGGTGAATCTGGCCTCCCGTGAGCTCCATCGTCTCATGGTTGGTTGAAAA …
Trifolium angustifolium clone TR-3 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★trnL-F★ITS8★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Trifolium angustifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records14–322n range16median16mode41records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1634×CCDB · ita-fl · CCDB · iapt · CCDB · iber-fl +7
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1983. Numeros cromosomaticos de plantas occidentales, 200-210.. Anales Jard. Bot. Madrid , 39(2): 519-524.
CCDB · iapt — IAPT/IOPB Chromosome Data 1
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · mediterranean
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · ipcn-api-dl — Baltisberger. 2006. IAPT/IOPB chromosome data 1. Taxon 55(2): 444.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn67-71 — PRITCHARD, A.J. 1969. Chromosome numbers in some species of Trifoli Austral. J. Agric. Res. 20: 883-887.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn75-78 — Kozuharov et al. 1975
CCDB · book-ipcn75-78 — Nielsen 1975
CCDB · book-ipcn75-78 — 32
CCDB · book-ipcn73-74 — KOZUHAROV, S. I. , A. V. PETROVA, & T. MARKOV A. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · book-ipcn73-74 — STRID, A. 1971. Chromosome numbers in some Albanian angiosperms. Bot. Notiser 124: 490-496.
CCDB · book-ipcn73-74 — VAN LOON, J. 1974. A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · CromoCat 2015 — Petrova, A. & S. Kozuharov. (1982). Cytotaxonomic study of genus Trifolium L. in Bulgaria. I. II. Phytology 19: 3-23; 20: 20-41.
CCDB · CromoCat 2015 — Baltisberger, M. & Voelger, M. (2006). IAPT/IOPB Chromosome Data 1 Taxon 55(2): 443-445
CCDB · CromoCat 2015 — Colombo, P., Marcenó, C. & Princiotta, R. (1983a). Números cromosomáticos de plantas occidentales, 200-210. Anales Jard. Bot. Madrid 39: 519-524.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1974c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 377-378.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1975b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVII]. Taxon 24(1): 145-146.
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Loon van, J. C. (1974). A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 583-587.
CCDB · CromoCat 2015 — Muñoz Rodríguez, A. F. (1993a). Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89-118.
CCDB · CromoCat 2015 — Nielsen, I. (1975). Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180-183.
CCDB · CromoCat 2015 — Pritchard, A. J. (1969). Chromosome numbers in some species of Trifolium. Austral. J. Agric. Res. 20: 883-887.
CCDB · CromoCat 2015 — Runemark, H. (2006). Reports (1473-1571). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 408-425
2n 145×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-atlas-flowering-plants +1
CCDB · ipcn-api-dl — LABADIE, J. 1976a. Contribution à l'etude caryosystematique des espeees halophiles du littoral languedocier (plus precisement, especes appartenant à la classe des Salicornietea). These, Universite du Languedoc. 222 pp.
CCDB · book-ipcn75-78 — Labadie 1976a
CCDB · book-atlas-flowering-plants — Karpechenko 1925
CCDB · CromoCat 2015 — Karpechenko, G. D. (1925). Karyologische studien über dir gattung Trifolium L. Bull. Appl. Bot., Genet. & Plant Breeding 14: 271-279.
CCDB · CromoCat 2015 — Labadie, J. P. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 636-639.
2n 322×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.
n 81×CCDB · Cannon, 2015
CCDB · Cannon, 2015 — Van Loon, J. C. & B. Kieft., 1980
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.992 ↗
08Occurrence & distribution
Record type37 085 records
Wild obs. + sensor33 891
Museum / vouchered2 620
Cultivated / captive71
Other503
Origin
Native873
Introduced6 075
Range
Area of Occupancy AOO63 532 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy65% within 1 km
≤100 m 12 406≤1 km 5 580≤10 km 9 542>10 km 313
27 841 georeferenced · 6 050 without coordinates
Open the mapobservation + sensor33 891
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 215≤1 km 417≤10 km 428>10 km 26
1 086 georeferenced · 1 534 without coordinates
Open the institutions mapphysical evidence2 620
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 3
3 georeferenced · 68 without coordinates
Open the mapnot free-living71
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions82 of 149 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 420 |
| Adelaide, AU | 212 |
| LDlocation not on record | 179 |
| MAlocation not on record | 126 |
| ISAlocation not on record | 95 |
| Moscow State Universitylocation not on record | 73 |
| València, ES | 72 |
| Mount Annan, AU | 68 |
| Badajoz, ES | 60 |
| CICYTEXlocation not on record | 54 |
| Museo Entomologico de Leonlocation not on record | 54 |
| BDBClocation not on record | 45 |
| BClocation not on record | 42 |
| Vitoria, ES | 42 |
| College of the Atlantic, Museumlocation not on record | 39 |
| Entomological Society of Latvialocation not on record | 38 |
| Barcelona, ES | 32 |
| Córdoba, ES | 29 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 27 |
| BRNUlocation not on record | 26 |
| ESP010location not on record | 26 |
| Madrid, ES | 26 |
| Wlocation not on record | 25 |
| Salamanca, ES | 25 |
| Hobart, AU | 22 |
| Kensington, AU | 21 |
| San Sebastián, ES | 20 |
| Adam Mickiewicz University in Poznańlocation not on record | 18 |
| Granada, ES | 17 |
| Canberra, AU | 17 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 17 |
| Canadian Department of Agriculturelocation not on record | 17 |
| Pamplona, ES | 16 |
| Sevilla, ES | 15 |
| NSW Office of Environment and Heritagelocation not on record | 15 |
| Corvallis, US | 15 |
| San Luis Obispo, US | 14 |
| Santa Cruz, US | 13 |
| Phyletisches Museum Jenalocation not on record | 13 |
| Kew, GB | 12 |
| Uniwersytet Jagiellońskilocation not on record | 12 |
| Alicante, ES | 11 |
| MeiseBGlocation not on record | 10 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| Jaén, ES | 9 |
| Pamplona, ES | 9 |
| Riverside, US | 9 |
| UChlocation not on record | 8 |
| UIBlocation not on record | 8 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 8 |
| Davis, US | 8 |
| Auckland, NZ | 8 |
| Christchurch, NZ | 8 |
| GBR016location not on record | 7 |
| Santiago de Compostela, ES | 7 |
| Parkville, AU | 7 |
| South Kensington, GB | 7 |
| Paris, FR | 6 |
| Görlitz, DE | 6 |
| Philadelphia, US | 6 |
| Bern, CH | 6 |
| Bourges, FR | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| AZE015location not on record | 5 |
| Saint Louis, US | 5 |
| GJOlocation not on record | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 5 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 5 |
| Palmerston, AU | 4 |
| San Jose, US | 4 |
| Boise, US | 4 |
| OLAlocation not on record | 4 |
| Claremont, US | 4 |
| Frankfurt am Main | 4 |
| UGentlocation not on record | 4 |
| Rishon Le Zion, IL | 4 |
| WTUlocation not on record | 4 |
| Oskarshamn, SE | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Olocation not on record | 3 |
| Santa Barbara, US | 3 |
| Pullman, US | 3 |
| PRClocation not on record | 3 |
| JBSlocation not on record | 3 |
| Bando, JP | 3 |
| San Diego, US | 3 |
| Stockholm, SE | 3 |
| Logan, US | 3 |
| Rotorua, NZ | 3 |
| Provincia di Livornolocation not on record | 3 |
| PRT004location not on record | 2 |
| Edinburgh, GB | 2 |
| Moscow, US | 2 |
| Uppsala, SE | 2 |
| Smithfield, AU | 2 |
| Wellington, NZ | 2 |
| Durham, US | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Boumlocation not on record | 2 |
| Batemans Bay, AU | 2 |
| University of Stellenboschlocation not on record | 2 |
| Wuzhou, CN | 2 |
| Henry Brockhouse Collectionlocation not on record | 2 |
| Arcata, US | 2 |
| Nagano City, JP | 2 |
| BG-NMNHSlocation not on record | 2 |
| Minia, EG | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Brisbane, AU | 2 |
| Monastir, TN | 2 |
| SVK001location not on record | 1 |
| Chapel Hill, US | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Coimbra, PT | 1 |
| Frauenfeld, CH | 1 |
| CZE096location not on record | 1 |
| Henderson, US | 1 |
| Palmerston North, NZ | 1 |
| San Francisco, US | 1 |
| Universite de Montpellierlocation not on record | 1 |
| Tampa, US | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| Porrentruy, CH | 1 |
| Armidale, AU | 1 |
| ESP109location not on record | 1 |
| Fort Bragg, US | 1 |
| CJBGlocation not on record | 1 |
| Portland, US | 1 |
| Provo, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| GB | 1 |
| ASUlocation not on record | 1 |
| CIBIOlocation not on record | 1 |
| CASlocation not on record | 1 |
| Gijón, ES | 1 |
| Turlock, US | 1 |
| POL003location not on record | 1 |
| EL PASO, US | 1 |
| ESP003location not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record | 1 |
| BFLlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Odawara, JP | 1 |
| GZUlocation not on record | 1 |
| Xiamen, CN | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
149 institutions · 2 459 of 2 620 vouchered records shown · 158 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Trifolium angustifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.6 °C 15.2–18.2
Seasonal swing summer↔winter10.4 °C
Max temp (day)20.5 °C 19.4–23.5
Min temp (night)11.1 °C 10.1–13.6
Precipitation103 mm/mo 58.8–155
Air humidity57.7 % 56.1–59.9
Moisture balance-34.5 mm/mo -87.8–26.9
Vapour deficit804 Pa 700–926
Wind speed3.20 m/s 2.90–4.30
Cloud cover13.9 % 12.7–41.2
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.