Trifidacanthus unifoliolatus

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifidacanthus

At a glance

Occurrence records45

Data sources6

Biological traits3

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Trifidacanthus unifoliolatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF45 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Trifidacanthus unifoliolatus est une espèce de plantes à fleurs dicotylédones de la famille des Fabaceae, sous-famille des Faboideae, originaire de l'Asie du Sud-Est. C'est l'unique espèce acceptée du genre Trifidacanthus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Plant height2 m

Life cycle & reproduction1

Life formshrub

Habitat & environment1

Climatewet tropical

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifidacanthus unifoliolatus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC377428.1 ↗601 bpChina · 1993

ACGT

GATGGCCCGCAAACAGTTTGACCGGAGAACGCGTTTATCTATCTGACCCGCGGGGGGGCTGGCACGATCCCGTCCTCTCCCCCCTGTCGA …

Trifidacanthus unifoliolatus TUS:Y.Tateishi et al. 1020113 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL2ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type45 records

Museum / vouchered41

Other4

Range

Area of Occupancy AOO48 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 41 records without

Open the institutions mapphysical evidence41

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	10
Beijing, CN	5
Guilin, CN	4
Chengdu, CN	4
Guangzhou, CN	3
Bronx, US	2
Kunming, CN	2
Changsha, CN	2
Zhejiang Universitylocation not on record	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Kew, GB	1
Nanjing, CN	1

12 institutions · 36 of 41 vouchered records shown · 5 without an institution code

09Environmental DNA1 detections

Where the DNA of Trifidacanthus unifoliolatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.