Triepeolus verbesinae

(Cockerell, 1897) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Triepeolus

At a glance

Occurrence records1 055

Data sources6

Biological traits0

DNA specimens12

eDNA detections0

Sources6 archives

Databases and archives Triepeolus verbesinae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 055 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 055 records

DNA & barcodingBOLD12 specimens

01Narrative

Triepeolus verbesinae is a species of cuckoo bee in the family Apidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triepeolus verbesinae has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

5Cmostly conserved

139Cvariable

265Gmostly conserved

293Tmostly conserved

379Tmostly conserved

544Amostly conserved

568Gmostly conserved

TATGCTATATATAATTTTTGCTATATGAGCTGGAATGATTGGTTCTTCAATAAGATTTATTATTCGTATGGAATTAAGATTACCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Triepeolus dacotensissame genus9.0%Triepeolus lunatussame genus9.3%Triepeolus mexicanussame genus9.3%Triepeolus brittainisame genus10.1%Triepeolus subalpinussame genus10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 055 records

Wild obs. + sensor182

Museum / vouchered873

Range

Area of Occupancy AOO800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 103≤1 km 49≤10 km 5>10 km 9

166 georeferenced · 16 without coordinates

Open the mapobservation + sensor182

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 17≤1 km 16≤10 km 68>10 km 6

107 georeferenced · 766 without coordinates

Open the institutions mapphysical evidence873

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alabamalocation not on record	329
Wuzhou, CN	233
	167
ASUlocation not on record	85
WIlocation not on record	25
La Jolla, US	10
Beltsville, US	7
Universidad Católica de Manizaleslocation not on record	7
San Diego, US	3
Champaign, US	2
Awka, NG	1
US	1
OSUClocation not on record	1
University of Arizona, Insect Collectionlocation not on record	1
University of Nebraska State Museumlocation not on record	1

15 institutions · 873 of 873 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Triepeolus verbesinae

At a glance

Sources6 archives

At a glance

Record type1 055 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Record type1 055 records