Tridens texanus

(S.Watson) Nash · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Tridens

At a glance

Occurrence records793

Data sources9

Biological traits10

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Tridens texanus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility793 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF793 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Tridens texanus là một loài thực vật có hoa trong họ Hòa thảo. Loài này được (S.Watson) Nash miêu tả khoa học đầu tiên năm 1903.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tridens texanus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKX582438.1 ↗663 bpMexico

ACGT

ACCTGCGGAAGGATCATTGTCGTGACCCTGAACAAAACAGACCGTGAACATGTCGTCCATGCCGCTGGGTAACAGGGCTGGCCCCCGTCA …

Tridens texanus voucher Peterson 24618 & Romaschenko (US) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tridens texanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records16–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · book-ipcn66 · CCDB · book-ipcn67-71

CCDB · book-ipcn66 — Gould 1966

CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.

2n 161×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Texas, Mexico

n 202×CCDB · book-ipcn67-71 · CCDB · Cave1958

CCDB · book-ipcn67-71 — REEDER, J.R. 1968. Notes on Mexican grasses VIII. Miscellaneous chromosome numbers - 2. Bull. Torrey Bot. Club 95: 69-86.

CCDB · Cave1958 — Gould 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type793 records

Wild obs. + sensor436

Museum / vouchered357

Range

Area of Occupancy AOO2 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 282≤1 km 42≤10 km 13>10 km 43

380 georeferenced · 56 without coordinates

Open the mapobservation + sensor436

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 120≤1 km 24≤10 km 35>10 km 17

196 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence357

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	108
Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record	55
University of Stellenboschlocation not on record	53
Bronx, US	30
Torreón, MX	25
Fort Worth, US	16
Mexico City, MX	10
Emporia, US	8
Wuzhou, CN	7
BAYLUlocation not on record	7
Saint Louis, US	7
Durango, MX	4
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record	4
Riverside, US	3
EL PASO, US	2
Austin, US	2
Tampa, US	1
Texas A&M Universitylocation not on record	1
Ann Arbor, US	1
Logan, US	1
Kew, GB	1
BClocation not on record	1
Texas Lutheran Universitylocation not on record	1
Lubbock, US	1
Jena Microbial Resource Collectionlocation not on record	1
WTUlocation not on record	1
Stephenville, US	1
ASUlocation not on record	1
San Angelo, US	1
Cenargenlocation not on record	1
Brasília, BR	1
Burlington, US	1

32 institutions · 357 of 357 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Tridens texanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)