Tridax rosea — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Tridax

At a glance

Occurrence records116

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Tridax rosea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility116 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF116 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Tridax rosea là một loài thực vật có hoa trong họ Cúc. Loài này được Sch.Bip. ex B.L.Rob. & Greenm. miêu tả khoa học đầu tiên năm 1896.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tridax rosea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKMT214865.1 ↗2 252 bpMexico

ACGT

CTTTTACACATTTAGATGAAGCGAGGGATTCGTCCATACCATCGGTAAAGTTTGGAAGACCACGACTGATCCTGAAAGGGAATGAATGGA …

UNVERIFIED: Tridax rosea contains matK genomic sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tridax rosea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 102×CCDB · book-ipcn65 · CCDB · ipcn-api-dl

CCDB · book-ipcn65 — Powell 1965

CCDB · ipcn-api-dl — Strother, J. L. & J. L. Panero. 2001. Chromosome studies: Mexican Compositae. Amer. J. Bot. 88(3): 499–502.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type116 records

Wild obs. + sensor35

Museum / vouchered81

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 18≤1 km 7≤10 km 2

27 georeferenced · 8 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 48≤1 km 1≤10 km 5>10 km 1

55 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	27
Mexico City, MX	12
Austin, US	11
Bronx, US	5
Mexico City, MX	5
Juriquilla, MX	5
Guasave, MX	4
Austin, US	3
Saint Louis, US	3
Wuzhou, CN	2
Tlalnepantla, MX	2
Chapingo, MX	1
Mexico City, MX	1

13 institutions · 81 of 81 vouchered records shown