Tridax procumbens
speciesAt a glance
Occurrence records35 992
Data sources15
Biological traits53
DNA specimens13
eDNA detections10
Sources15 archives
Databases and archives Tridax procumbens's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility35 992 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics13 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources53 traits
Chemical compositionDukesPhytochem · LOTUS85 compounds
Occurrence & distributionGBIF35 992 records
Environmental DNA1 datasets · 5 countries10 detections
DNA & barcodingBOLD · NCBI13 specimens
Genome at a glanceCCDB · GIFT2n = 36
01Narrative
Tridax procumbens, commonly known as coatbuttons or tridax daisy, is a species of flowering plant in the family Asteraceae. It is best known as a widespread weed and pest plant. It is native to the tropical Americas, but it has been introduced to tropical, subtropical, and mild temperate regions worldwide. It is listed as a noxious weed in the United States and has pest status in nine states.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology16
Fruit length2 mm
⚠ sources differ — AusTraits: 2 mm · GIFT: 2.5 mm
Fruit length max2.5 mm
Fruit length min2 mm
Leaf length35 mm
Leaf length max70 mm
Leaf length min20 mm
Leaf width15 mm
Leaf width max40 mm
Leaf width min10 mm
Petiole length0.75 cm
Plant height0.25 m
⚠ sources differ — GIFT: 0.25 m · AusTraits: 0.35 m · TRY: 0.055 m
Plant height max0.5 m
Plant height min0 m
Seed mass0.682 mg
Seed mass max0.79 mg
Seed mass min0.58 mg
Life cycle & reproduction12
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal type detailedanemochorous
Flower colourwhite
Flowering endJun
Flowering startApr
Flowering timeyyyyyynnnnnn
Life formsubshrub
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTa weed of cultivation, also on waste ground, invader of bare soil, forms patches and mats
Leaf compoundnesssimple
Leaf shapelanceolate ovate
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
Physiology & chemistry7
Leaf dry-matter content (LDMC)174 mg/g
Leaf n30 mg/g
Leaf p3 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)39.9 mm²/mg
Wood density187 mg/cm³
Other traits2
Seeds per fruit11-100
Shoot orientationascending
03Chemical composition85 compounds
Compounds documented for Tridax procumbens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols9
Stigmastane steroids6
Fatty alcohols6
Oleanane triterpenoids5
Oxo fatty acids4
Documented compounds85 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| CARBOHYDRATES | 408,000 ppm | DukesPhytochem | |
| PROTEIN | 263,000 ppm | DukesPhytochem | |
| FIBER | 170,000 ppm | DukesPhytochem | |
| ASH | 159,000 ppm | DukesPhytochem | |
| K2O | 84,000 ppm | DukesPhytochem | |
| CAO | 42,000 ppm | DukesPhytochem | |
| FAT | 18,000 ppm | DukesPhytochem | |
| MGO | 17,000 ppm | DukesPhytochem | |
| P2O5 | 11,000 ppm | DukesPhytochem |
05DNA & barcoding13 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tridax procumbens has left across the world's sequence archives.
At a glance
DNA specimens13
Marker genes5
GenBank sequences10
eDNA detections10
Countries5
The DNA barcodea real sequence read deposited for this species
GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCATAGCAGAACGACCTGTGAACTAGTACTTATAACAAGGTGTAGCGG …
Tridax procumbens voucher ABANERJEE75559b small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Tridax procumbens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidypolyploid inferred
Chromosome records36–602n range36median36mode17records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3616×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +6
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · ipcn-api-dl — Sidhu, M. & S. S. Pelia. 1987. Karyomorphology of some species of weeds -- Compositae. J. Cytol. Genet. 22: 143–150.
CCDB · ipcn-api-dl — Baltisberger, M. 1990. Chromosome numbers of some plants from Papua New Guinea. Bot. Helv. 100: 97–100.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1984. Karyotype studies in Asteraceae. Cell Chromosome Res. 7: 26–28.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1985. Chromosome morphology of Tridax procumbens L. Cell Chromosome Res. 8: 49–50.
CCDB · ipcn-api-dl — Jose, J. C. & P. M. Mathew. 1995. Chromosome numbers in the south Indian Heliantheae (Compositae). Compositae Newslett. 27: 7–10.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1981. In Chromosome number reports LXX. Taxon 30: 78.
CCDB · ipcn-api-dl — Xie, Z. y. & C. m. Zheng. 2003. Cytological studies on 13 species of Compositae from Hainan, China. Acta Phytotax. Sin. 41(6): 545–552.
CCDB · book-ipcn66 — Harvey 1966a
CCDB · book-ipcn72 — BHATTACHARYYA, G.N . & A.K. SHARMA. 1970. Cytological study of some members of Compositae. Bull. Bot. Soc. Bengal 24: 31-36.
CCDB · book-ipcn73-74 — SINGH, N.K. 1972. Cytological investigations in some Compositae of I
CCDB · book-indian_vol1 — Raghavan, T.S. & Venkatasubban, K.R. 1941b; Mehra, P.N. & Sidhu, S.S. 1960; Turner, B.L., Ellison, W.L. & King, R. 1961 ; Turner, B.L. & King, R.M. 1964; Mehra, P.N. et al. 1965 ; Powell, A.M. 1965 ; Turner, B.L. & Lewis, W.H. 1965 ; Harvey 1966 ; Tandon, S.L. & Bhalla, I. 1968; Gupta, P.K. 1969b; Powell, A.M. & King, R.M. 1969b ; Rogers, S. 1969 ; Shukur, A. 1969 ; Bhattacharyya, G.N. & Sharma, A.K. 1970; Hsu, C.- C. 1970 ; Powell, A.M. & Sikes, S. 1970 ; Torres, A.M. & Liogier, A.H. 1970; Singh, N.K. 1972; Solbrig, O.T. eta!. 1972; Mehra, P.N. & Remanandan, P. 1974; Keil, D.J. & Stuessy, T.F. 1977; Bir, S.S. & Sidhu, M. 1980
CCDB · eflora
CCDB · book-atlas-flowering-plants — Raghavan & V. '41b
CCDB · iapt — IAPT/IOPB Chromosome Data 17
GIFT · GIFT (floras)
2n 601×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Langlet, O.F.J. 1936 ; Delay, C. 1947 ; Love, A. & Love, D. 1956b ; Sokolov- skaya, A.P. & Strelkova, o.S. (Fedorov) ; Gadella, T.W.J. & Kliphuis, E. 1966 ; Knaben, G. & Engelskjon, T. 1967 ; Leveque, M~ & Gorenfiot, R. 1969 ; Majovsk:Y, J. et at. 1970b; Brand, C.V.D. eta!. 1919
n 1818×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +3
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · book-ipcn65 — Powell 1965; Mehra et al. 1965; Turner & L. 1965
CCDB · ipcn-api-dl — Razaq, Z. A., S. Khatoon & S. I. Ali. 1988. A contribution to the chromosome numbers of Compositae from Pakistan. Pakistan J. Bot. 20: 177–189.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1982. Chromosome numbers of some plants of Pakistan. Pakistan J. Bot. 14: 117–129.
CCDB · ipcn-api-dl — Husaini, S. W. H. & G. A. Iwo. 1990. Cytology of some weedy species of the family Compositae (Asteraceae) from Jos Plateau, Nigeria. Feddes Repert. 101: 49–62.
CCDB · ipcn-api-dl — Gill, L. S. & I. D. Omoigui. 1987. The incidence of polyploidy in family Asteraceae in southern Nigeria. Rev. Cytol. Biol. Vég., Bot. 10: 177–184.
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Jose, J. C. & P. M. Mathew. 1995. Chromosome numbers in the south Indian Heliantheae (Compositae). Compositae Newslett. 27: 7–10.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1981. In Chromosome number reports LXX. Taxon 30: 78.
CCDB · ipcn-api-dl — Keil, D. J. & T. F. Stuessy. 1975. Chromosome counts of Compositae from the United States, Mexico and Guatemala. Rhodora 77: 171–195.
CCDB · ipcn-api-dl — Keil, D. J. & T. F. Stuessy. 1977. Chromosome counts of Compositae from Mexico and the United States. Amer. J. Bot. 64: 791–798.
CCDB · ipcn-api-dl — Koul, A. K., A. K. Wakhlu & J. L. KARIHALOO. 1976a. Chromosome numbers of some flowering plants of Jammu (western Himalayas). II. CIS Chromosome Inform. Serv. 20: 32–33.
CCDB · book-ipcn72 — SOLBRIG, O.T., D.W. KYHOS, M. POWELL, & P.H. RAVEN. 1972. Chromosome numbers in Compositae VIII: Heliantheae. Amer. J. Bot. 59: 869-878.
CCDB · book-ipcn67-71 — HSU, c.-c. 1970. Preliminary chromosome studies on the vascular plants of Taiwan (III) The aster family, Compositae. Taiwania 15: 17-29.
CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.
CCDB · book-ipcn73-74 — SINGH, N.K. 1972. Cytological investigations in some Compositae of I
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type35 992 records
Wild obs. + sensor30 946
Museum / vouchered4 702
Cultivated / captive1
Other343
Origin
Native68
Introduced808
Range
Area of Occupancy AOO69 816 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy87% within 1 km
≤100 m 16 778≤1 km 3 067≤10 km 1 874>10 km 1 111
22 830 georeferenced · 8 116 without coordinates
Open the mapobservation + sensor30 946
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy69% within 1 km
≤100 m 762≤1 km 99≤10 km 300>10 km 87
1 248 georeferenced · 3 454 without coordinates
Open the institutions mapphysical evidence4 702
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions152 of 335 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 378 |
| Durango, MX | 254 |
| Brisbane, AU | 229 |
| Austin, US | 213 |
| Mexico City, MX | 171 |
| Bronx, US | 139 |
| UNIVASFlocation not on record | 113 |
| Palmerston, AU | 101 |
| Kew, GB | 91 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 86 |
| Tampa, US | 69 |
| National Biodiversity Institute, Costa Ricalocation not on record | 69 |
| UNESP-ISlocation not on record | 63 |
| Canberra, AU | 62 |
| Taipei, TW | 56 |
| University of Stellenboschlocation not on record | 55 |
| TAIElocation not on record | 50 |
| Université de Strasbourglocation not on record | 42 |
| Kensington, AU | 41 |
| Antiguo Cuscatlán, SV | 40 |
| Chaguaramas, TT | 39 |
| Mérida, MX | 39 |
| Masindi, UG | 38 |
| Laboratorio de Ictiologialocation not on record | 34 |
| Universidade Federal do Vale do São Franciscolocation not on record | 33 |
| UFBAlocation not on record | 33 |
| Pretoria, ZA | 33 |
| Universidade Federal de Sergipe (UFS)location not on record | 32 |
| Universidade Federal do Maranhãolocation not on record | 31 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 31 |
| Berlin, DE | 31 |
| Altos de Pipe, VE | 30 |
| Leiden University Medical Centerlocation not on record | 28 |
| León, NI | 27 |
| Jena Microbial Resource Collectionlocation not on record | 27 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 27 |
| Ural Federal University "B. N. Yeltsin"location not on record | 26 |
| Mount Annan, AU | 25 |
| JBRJlocation not on record | 25 |
| Miami, US | 24 |
| Universidad Nacional de Colombia (UNAL)location not on record | 22 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 22 |
| Cenargenlocation not on record | 22 |
| Fortaleza, BR | 22 |
| LSF/FSA/UAClocation not on record | 22 |
| Brasília, BR | 22 |
| Departamento de Sistematica e Ecologialocation not on record | 21 |
| Wuzhou, CN | 20 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 20 |
| Durban, ZA | 20 |
| Kathmandu, NP | 19 |
| Culiacán, MX | 19 |
| CASlocation not on record | 18 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 18 |
| Riverside, US | 18 |
| UFMSlocation not on record | 18 |
| Blumenau, BR | 18 |
| MeiseBGlocation not on record | 17 |
| Stockholm, SE | 17 |
| Smithfield, AU | 17 |
| Museo Entomologico de Leonlocation not on record | 17 |
| Odawara, JP | 17 |
| Paris, FR | 17 |
| WAGlocation not on record | 16 |
| HNBlocation not on record | 16 |
| Austin, US | 16 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 15 |
| University of Papua New Guinealocation not on record | 15 |
| ASUlocation not on record | 15 |
| Frankfurt am Main | 15 |
| Taipei, TW | 15 |
| St. Augustine, TT | 14 |
| Taipei, TW | 14 |
| HUENFlocation not on record | 14 |
| UFRPElocation not on record | 14 |
| BISHlocation not on record | 14 |
| Moscow State Universitylocation not on record | 14 |
| Salvador, BR | 14 |
| Sydney, AU | 14 |
| Adelaide, AU | 13 |
| Tuxtla Gutiérrez, MX | 12 |
| UnBlocation not on record | 12 |
| Yaoundé, CM | 12 |
| Honolulu, US | 12 |
| Plocation not on record | 11 |
| Tapachula, MX | 11 |
| Université du Lomélocation not on record | 11 |
| Brasília, BR | 11 |
| URCAlocation not on record | 10 |
| Feira de Santana, BR | 10 |
| Córdoba, AR | 9 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 9 |
| UFESlocation not on record | 9 |
| Pondicherry, IN | 9 |
| San Francisco de Campeche, MX | 9 |
| Beijing, CN | 9 |
| INMAlocation not on record | 8 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 8 |
| Forest Herbarium Ibadan (FHI)location not on record | 8 |
| Uberlândia, BR | 8 |
| Nishihara, JP | 8 |
| Tlalnepantla, MX | 8 |
| San José, CR | 8 |
| UEMlocation not on record | 8 |
| UNICAMPlocation not on record | 7 |
| Xiamen, CN | 7 |
| UTFPR-CPlocation not on record | 7 |
| LSFlocation not on record | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| National Museums of Kenyalocation not on record | 7 |
| EFGlocation not on record | 7 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 7 |
| Christchurch, NZ | 7 |
| Ciudad de México, MX | 7 |
| Edinburgh, GB | 7 |
| UFPElocation not on record | 7 |
| Federal University of Espírito Santolocation not on record | 7 |
| Dehra Dun, IN | 7 |
| Santa Teresa, BR | 6 |
| Juriquilla, MX | 6 |
| Chicago, US | 6 |
| MAlocation not on record | 6 |
| BAYLUlocation not on record | 6 |
| LDlocation not on record | 6 |
| CPATSAlocation not on record | 6 |
| UFMGlocation not on record | 6 |
| Tuxtla Gutiérrez, MX | 6 |
| Campo Mourão, BR | 6 |
| Chapel Hill, US | 6 |
| CNF-UFHBlocation not on record | 6 |
| Cruz das Almas, BR | 5 |
| UFPIlocation not on record | 5 |
| Autlán de Navarro, MX | 5 |
| EL PASO, US | 5 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 5 |
| Armidale, AU | 5 |
| Mérida, MX | 5 |
| CEPLAClocation not on record | 5 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 5 |
| Chongqing Museumlocation not on record | 5 |
| Fort Worth, US | 5 |
| Baroda, IN | 5 |
| Auckland, NZ | 5 |
| Kunming, CN | 5 |
| UNITINSlocation not on record | 5 |
| Foz do Iguaçu, BR | 5 |
| San Diego, US | 5 |
| Pelotas, BR | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| James Cook Townsvillelocation not on record | 4 |
| ESALQlocation not on record | 4 |
| Teresina, BR | 4 |
| Maringá, BR | 4 |
| Cambridge, US | 4 |
| Calabar, NG | 4 |
| BMlocation not on record | 4 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 4 |
| Guangzhou, CN | 4 |
| INBIOlocation not on record | 4 |
| Bloomington, US | 4 |
| Haramaya Universitylocation not on record | 4 |
| San Isidro, AR | 4 |
| Montréal, CA | 3 |
| Hermosillo, MX | 3 |
| UNESP, Campus São José Rio Prêtolocation not on record | 3 |
| Changsha, CN | 3 |
| OTSlocation not on record | 3 |
| Sangmiung Universitylocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 3 |
| South Kensington, GB | 3 |
| Vancouver, CA | 3 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 3 |
| HACAMlocation not on record | 3 |
| Glocation not on record | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| Addis Ababa, ET | 3 |
| UNESP-RClocation not on record | 3 |
| UFRRJlocation not on record | 3 |
| Cuiabá, BR | 3 |
| San Francisco, US | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Tsukuba, JP | 3 |
| Université de Bordeauxlocation not on record | 3 |
| UNEMATlocation not on record | 3 |
| Seropédica, BR | 3 |
| Burlington, US | 3 |
| UEMAlocation not on record | 3 |
| Herbier National du Gabonlocation not on record | 3 |
| Clocation not on record | 3 |
| Instituto de Investigação Científica Tropicallocation not on record | 3 |
| Uppsala, SE | 2 |
| University of Johannesburglocation not on record | 2 |
| Monastir, TN | 2 |
| IECOSlocation not on record | 2 |
| Universidade de São Paulolocation not on record | 2 |
| Puerto Ayora, EC | 2 |
| UNESP-IBILCElocation not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Londrina, BR | 2 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 2 |
| UFAClocation not on record | 2 |
| UNIVILLElocation not on record | 2 |
| Cascavel, BR | 2 |
| TAFORI-LSRClocation not on record | 2 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| Montpellier, FR | 2 |
| Guasave, MX | 2 |
| Universidade Federal do Espírito Santolocation not on record | 2 |
| UFERSAlocation not on record | 2 |
| Jataí / Setor Industrial, BR | 2 |
| Minia, EG | 2 |
| LISClocation not on record | 2 |
| UFVJMlocation not on record | 2 |
| UNESP-FCAlocation not on record | 2 |
| Zacatecas, MX | 2 |
| UEPAlocation not on record | 2 |
| UFABClocation not on record | 2 |
| Bogotá, D.C., CO | 2 |
| Mexico City, MX | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| UESBlocation not on record | 2 |
| Wlocation not on record | 2 |
| Lake Charles, US | 2 |
| Puebla, MX | 2 |
| Forestry Research Institute of Nigerialocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Provo, US | 2 |
| La Paz, BO | 2 |
| Corrientes, AR | 2 |
| WTUlocation not on record | 2 |
| CMULlocation not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Davis, US | 2 |
| Guatemala City, GT | 2 |
| Campo Grande, BR | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| EAlocation not on record | 2 |
| LGlocation not on record | 2 |
| TNMlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Ilhéus, BR | 2 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| Awka, NG | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Goucher Collegelocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Elocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| Salamanca, ES | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| UNISANTAlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Hobart, AU | 1 |
| Universidade Federal de Pelotaslocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| University of Calabar/Department of Plant and Ecological Studies Herbariumlocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| FIlocation not on record | 1 |
| Arusha, TZ | 1 |
| Phoenix, US | 1 |
| Dublin, IE | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| UCAMlocation not on record | 1 |
| QCNElocation not on record | 1 |
| Clemson, US | 1 |
| Santarém, BR | 1 |
| Universidad de los Llanos (UniLlanos)location not on record | 1 |
| FUNEDlocation not on record | 1 |
| Ann Arbor, US | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| DSMlocation not on record | 1 |
| Coimbra, PT | 1 |
| Montecillo, Texcoco, MX | 1 |
| Ciudad de México, MX | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Cape Town, ZA | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| UNESClocation not on record | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 1 |
| UERJlocation not on record | 1 |
| Moscow, US | 1 |
| The CB Rhizobium Collectionlocation not on record | 1 |
| UFSCarlocation not on record | 1 |
| UDESC-CAVlocation not on record | 1 |
| Llocation not on record | 1 |
| Toyama, JP | 1 |
| University of Zhejianglocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| NHMJlocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Tempe, US | 1 |
| UTFPR-DVlocation not on record | 1 |
| BRLUlocation not on record | 1 |
| Loja, EC | 1 |
| UTFPR-SLlocation not on record | 1 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 1 |
| Williamsburg, US | 1 |
| Nishihara, JP | 1 |
| Claremont, US | 1 |
| Bangkok, TH | 1 |
| Toronto, CA | 1 |
| Cambridge, US | 1 |
| Jinghong, CN | 1 |
| Ojo, NG | 1 |
| Dover, US | 1 |
| Dekalb, US | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| HEMlocation not on record | 1 |
| Göteborg, SE | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Chadron, US | 1 |
| Aarhus, DK | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| US | 1 |
335 institutions · 4 457 of 4 702 vouchered records shown · 243 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Tridax procumbens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map5 countries0
In dry areas and along bunds in road side an…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.8 °C 16.3–28.1
Seasonal swing summer↔winter11.4 °C
Max temp (day)29.5 °C 21.5–31.9
Min temp (night)19.5 °C 10.7–24.6
Precipitation21.2 mm/mo 8.10–198
Air humidity58.7 % 44.2–64.1
Moisture balance-55.8 mm/mo -125–28.5
Vapour deficit1,288 Pa 803–1,787
Wind speed2.50 m/s 1.50–4.00
Cloud cover21.3 % 13.1–49.2
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.