Tridactylina kirilowii

(Turcz.) Sch.Bip. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Tridactylina

At a glance

Occurrence records165

Data sources5

Biological traits11

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Tridactylina kirilowii's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility165 records↗

NCBIUS National Library of Medicinesequences↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF165 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Tridactylina is a genus of flowering plants in the chamomile tribe within the daisy family. Species The only known species is Tridactylina kirilowii, native to Siberia.Flann, C (ed) 2009+ Global Compositae Checklist

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max0.35 m

Plant height min0.06 m

Life cycle & reproduction5

Flowering endSep

Flowering startJul

Life formannual

Life spanannual

Raunkiær life formtherophyte

Habitat & environment4

Climatetemperate

Growth formherb

Habitat GIFTlakes, rivers, sand, stony places

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tridactylina kirilowii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSAB359780.1 ↗222 bp

ACGT

ATCGCGTCGCCCCCCACAATTCTCCTCAAAAGGGAAGTTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGA …

Tridactylina kirilowii gene for internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tridactylina kirilowii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · iapt

CCDB · iapt

08Occurrence & distribution

Record type165 records

Wild obs. + sensor155

Museum / vouchered10

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 90≤1 km 7≤10 km 10>10 km 2

109 georeferenced · 46 without coordinates

Open the mapobservation + sensor155

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Moscow State Universitylocation not on record	9
Irkutsk State Universitylocation not on record	1

2 institutions · 10 of 10 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)