Triclistus pallipes

Holmgren, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Triclistus

At a glance

Occurrence records26

Data sources7

Biological traits0

DNA specimens9

eDNA detections9

Sources7 archives

Databases and archives Triclistus pallipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF26 records

Environmental DNA3 datasets · 3 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Triclistus pallipes is a species of ichneumon wasp in the family Ichneumonidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triclistus pallipes has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections9

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P661 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Diversity (π)5.2%

Haplotypes2

BINs3

Most divergent pair4.2%

Where individuals differ — all 71 variable positions, in barcode order

10Cmostly conserved

37Amostly conserved

43Amostly conserved

55Tvariable

74Cmostly conserved

82Tvariable

83Cmostly conserved

109Cmostly conserved

125Cmostly conserved

127Tmostly conserved

130Amostly conserved

133Tvariable

139Tmostly conserved

175Tvariable

184Amostly conserved

205Tvariable

206Cmostly conserved

208Cmostly conserved

215Cmostly conserved

217Tmostly conserved

220Avariable

223Tvariable

229Tmostly conserved

235Amostly conserved

238Tmostly conserved

253Tvariable

274Avariable

284Tmostly conserved

301Tmostly conserved

302Amostly conserved

325Amostly conserved

328Tmostly conserved

338Avariable

343Tmostly conserved

346Tvariable

349Amostly conserved

367Amostly conserved

376Amostly conserved

398Cmostly conserved

400Tmostly conserved

409Tvariable

412Gmostly conserved

418Tvariable

427Tmostly conserved

439Amostly conserved

445Tmostly conserved

466Tmostly conserved

475Cvariable

482Tmostly conserved

489Avariable

508Tmostly conserved

511Cmostly conserved

523Amostly conserved

529Avariable

541Tmostly conserved

550Tvariable

553Amostly conserved

556Amostly conserved

560Tmostly conserved

565Avariable

572Tmostly conserved

586Tmostly conserved

592Tmostly conserved

604Tmostly conserved

610Tmostly conserved

619Tmostly conserved

622Amostly conserved

628Tvariable

631Tvariable

637Cvariable

649Cvariable

AATTTTATACTTTATTTTTGGAATCTGATCAGGAACAATAGGATCATCAACTAGTTTAATTATTCGACTTCAACTAAGATCTCCTTTTAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Triclistus podagricussame genus6.5%Triclistus aitkenisame genus6.7%Triclistus vaxinussame genus7.3%Triclistus brunnipessame genus11.3%Triclistus lativentrissame genus11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor2

Museum / vouchered24

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 8>10 km 1

9 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ULLlocation not on record	10
Facultad de Ingeniería y Ciencias, Universidad Autónoma de Tamaulipaslocation not on record	5
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	2
Olocation not on record	1
Stockholm, SE	1
South Kensington, GB	1
MZLUlocation not on record	1
NHMOlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

10 institutions · 24 of 24 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Triclistus pallipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys3

Countries3

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

1. Forest & WoodlandWet

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 8.30–16.0

Seasonal swing summer↔winter23.6 °C

Max temp (day)18.0 °C 11.9–20.3

Min temp (night)11.1 °C 4.40–11.6

Precipitation99.9 mm/mo 66.7–201

Air humidity62.8 % 56.7–64.6

Moisture balance-2.50 mm/mo -39.1–102

Vapour deficit566 Pa 392–789

Wind speed3.10 m/s 2.50–4.90

Cloud cover47.3 % 37.9–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)