Trichostema oblongum

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Trichostema

At a glance

Occurrence records566

Data sources10

Biological traits13

DNA specimens6

eDNA detections4

Sources10 archives

Databases and archives Trichostema oblongum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility566 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF566 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Trichostema oblongum, known by the common names oblong bluecurls and mountain bluecurls, is a species of flowering plant in the mint family . It is native to California and the Northwestern United States in Oregon, Idaho, and Washington, and north into British Columbia, Canada. Its habitat includes dry margins of meadows and streambanks in Yellow pine forest, Red Fir Forest, Lodgepole pine Forest, Subalpine Forest, California mixed evergreen forest, and North Coastal Coniferous Forest plant communities. It grows at 100 - in elevation.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.874 mg

Seed mass max0.874 mg

Seed mass min0.874 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichostema oblongum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences6

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219568.1 ↗340 bpCanada · 1996

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Trichostema oblongum voucher CCDB-24916-A07 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trichostema oblongum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Lewis H. 1945, 1960

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type566 records

Wild obs. + sensor233

Museum / vouchered333

Origin

Native1

Range

Area of Occupancy AOO1 572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 144≤1 km 11≤10 km 11>10 km 5

171 georeferenced · 62 without coordinates

Open the mapobservation + sensor233

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 7≤1 km 130≤10 km 66>10 km 3

206 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence333

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	52
Davis, US	21
Corvallis, US	20
Santa Barbara, US	16
Pullman, US	14
WTUlocation not on record	13
Claremont, US	12
Los Angeles, US	10
Arcata, US	10
CASlocation not on record	7
Canadian Department of Agriculturelocation not on record	6
San Diego, US	6
Bronx, US	6
Angwin, US	6
Riverside, US	3
San Jose, US	3
San Luis Obispo, US	3
STNFlocation not on record	3
Fredericton Stock Culture Collectionlocation not on record	3
US	2
Bloomington, US	2
Ashland, US	2
Boise, US	2
Cheney, US	2
Chapel Hill, US	2
Columbia, US	2
San Francisco, US	1
University of British Columbia, Herbariumlocation not on record	1
US	1
Northridge, US	1
Bend, US	1
KNFYlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Santa Cruz, US	1
EL PASO, US	1
Wellington, NZ	1
Vancouver, CA	1
Victoria, CA	1
Weber State Universitylocation not on record	1
ASUlocation not on record	1

40 institutions · 242 of 333 vouchered records shown · 91 without an institution code

09Environmental DNA4 detections

Where the DNA of Trichostema oblongum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Mountain meadow opening in forest, seepage a…on S-facing seepage slope with shallow soils…moist sandy soil of gravelly, swaley flat in…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 17.8–17.8

Seasonal swing summer↔winter24.5 °C

Max temp (day)24.0 °C

Min temp (night)10.9 °C

Precipitation52.0 mm/mo

Air humidity51.9 %

Moisture balance-97.8 mm/mo

Vapour deficit994 Pa

Wind speed2.30 m/s

Cloud cover33.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)