Trichostema laxum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Trichostema

At a glance

Occurrence records572

Data sources8

Biological traits13

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Trichostema laxum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility572 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF572 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Trichostema laxum is a species of flowering plant in the mint family, known by the common name turpentine weed from the foliage's scent.Jepson: Trichostema laxum'

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.96 mg

Seed mass max0.96 mg

Seed mass min0.96 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichostema laxum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSEF508076.1 ↗605 bp

ACGT

TCGAAACCTGCAAAGCAGACCGCGAACACGTGTTTAACAAAATCGGGACGACGGCCCCGGCTGCCGTCCCAACCCCCGTCGGCGTGCGCG …

Trichostema laxum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1ITS2

fungal barcode

08Occurrence & distribution

Record type572 records

Wild obs. + sensor292

Museum / vouchered280

Range

Area of Occupancy AOO1 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 152≤1 km 30≤10 km 42>10 km 22

246 georeferenced · 46 without coordinates

Open the mapobservation + sensor292

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 8≤1 km 78≤10 km 58>10 km 3

147 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence280

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	44
Arcata, US	28
Davis, US	28
Angwin, US	17
Claremont, US	15
Santa Barbara, US	11
Canadian Department of Agriculturelocation not on record	9
Riverside, US	7
San Diego, US	5
Ashland, US	4
San Luis Obispo, US	4
EL PASO, US	3
Severin-McDaniel Insect Collectionlocation not on record	2
STNFlocation not on record	2
Los Angeles, US	2
San Bernardino, US	1
US	1
Paris, FR	1
CASlocation not on record	1
Chapel Hill, US	1
WTUlocation not on record	1
University of Stellenboschlocation not on record	1
Bronx, US	1
GAlocation not on record	1
Henderson, US	1
Istituto Agrario Castelnuovolocation not on record	1
Bangkok, TH	1
ASUlocation not on record	1
Bloomington, US	1
Macomb, US	1
Boise, US	1

31 institutions · 197 of 280 vouchered records shown · 83 without an institution code

09Environmental DNA1 detections

Where the DNA of Trichostema laxum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.