Trichosporon asahii

Akagi ex Sugita, A.Nishikawa & Shinoda · species

image placeholder — illustration coming later

Fungi/Ascomycota/Saccharomycetes/Saccharomycetales/Dipodascaceae/Trichosporon

At a glance

Occurrence records8

Data sources7

Biological traits0

DNA specimens118

eDNA detections5

Sources7 archives

Databases and archives Trichosporon asahii's data was compiled from.

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics118 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI118 specimens

Genome at a glanceGoaT · NCBI≈25 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding118 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichosporon asahii has left across the world's sequence archives.

At a glance

DNA specimens118

Marker genes5

GenBank sequences10

eDNA detections5

Countries10

The DNA barcodea real sequence read deposited for this species

ITSPZ245271.1 ↗476 bpIndia · 2024

ACGT

ACTATATCCACTTACACCTGTGAACTGTTCTACTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTA …

Trichosporon asahii isolate AP6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS228S-D1-D25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Trichosporon asahii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈25 187 200 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Trichosporon asahii0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness92.6% BUSCO

08Occurrence & distribution

Record type8 records

Museum / vouchered5

Cultivated / captive3

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Trichosporon asahii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Pine(Softwood) dowel buried in soil of a con…Birch(Hardwood) dowel buried in soil of a co…Spruce(Softwood) dowel buried in soil of a c…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 12.8–14.5

Seasonal swing summer↔winter26.8 °C

Max temp (day)17.4 °C 15.7–17.4

Min temp (night)10.8 °C 9.70–10.8

Precipitation102 mm/mo 94.4–102

Air humidity60.9 % 60.9–62.3

Moisture balance8.00 mm/mo 8.00–18.2

Vapour deficit647 Pa 565–647

Wind speed2.40 m/s

Cloud cover58.9 % 58.8–58.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)