Trichosanthes pentaphylla

F.Muell. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Cucurbitaceae/Trichosanthes

At a glance

Occurrence records152

Data sources6

Biological traits23

DNA specimens14

eDNA detections13

Sources6 archives

Databases and archives Trichosanthes pentaphylla's data was compiled from.

GBIFGlobal Biodiversity Information Facility152 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF152 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD · NCBI14 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology9

Fruit length60 mm

Fruit width40 mm

Leaf length75 mm

Leaf size6 300 mm²

Leaf width45 mm

Petiole length5.5 cm

Seed length13 mm

Seed mass86 mg

Seed width7.5 mm

Life cycle & reproduction5

Dispersal typeanimal

Life formclimbing perennial

Life spanperennial

Pollination syndromebee

Resprouting capacityfire_killed

Habitat & environment7

Climatewet tropical

Fruit fleshinessfleshy

Fruit typeberry

Growth formclimber

Leaf compoundnesscompound

Leaf shapeobovate ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichosanthes pentaphylla has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences10

eDNA detections13

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHF586706.1 ↗741 bp

ACGT

AGCGGGTAGTCCCGCCTGACCTGGGGTCGCGTCGAGAGCATCGTCTTTGGGGACGACATTCAGAGGGTCGGCAAAGGAGTCCCCGCTCGC …

Trichosanthes pentaphylla genomic DNA containing ITS1, 5.8S rRNA gene, ITS2, specimen voucher CNS<AUS>:W.Cooper 2103

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK7★rbcL1★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type152 records

Wild obs. + sensor24

Museum / vouchered116

Other12

Origin

Native3

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 10≤1 km 6>10 km 1

17 georeferenced · 7 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 23≤1 km 38≤10 km 19>10 km 9

89 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	61
Brisbane, AU	31
Museo Entomologico de Leonlocation not on record	7
Canberra, AU	4
Mount Annan, AU	2
James Cook Townsvillelocation not on record	1
Uppsala, SE	1
Monastir, TN	1
Palmerston, AU	1

9 institutions · 109 of 116 vouchered records shown · 3 without an institution code

09Environmental DNA13 detections

Where the DNA of Trichosanthes pentaphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–25.1

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C 28.4–28.5

Min temp (night)15.0 °C 15.0–21.2

Precipitation15.6 mm/mo 15.6–259

Air humidity43.4 % 43.4–56.5

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa 1,397–1,624

Wind speed4.00 m/s

Cloud cover18.1 % 18.1–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)