Trichosanthes dioica

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Cucurbitaceae/Trichosanthes

At a glance

Occurrence records30

Data sources13

Biological traits11

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Trichosanthes dioica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS · NPASS43 compounds

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 22

01Narrative

Trichosanthes dioica est une espèce de plantes à fleurs dicotylédones de la famille des Cucurbitaceae, originaire du sous-continent indien et de Birmanie. C'est une plante herbacée vivace, dioïque, à port rampant ou grimpant. Les fruits sont des baies ovoïdes de 5 à 15 cm de long, de couleur verte, avec des bandes blanches longitudinales. Ils sont consommés comme légumes, notamment en Inde.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Life formclimber

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Growth formclimber

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition43 compounds

Compounds documented for Trichosanthes dioica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Flavonols7

Multiflorane triterpenoids6

Chalcones5

Lupane triterpenoids4

Flavanones2

Documented compounds43 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-5-hydroxy-7-methoxy-6-methyl-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(2S)-5-hydroxy-7-methoxy-6-methyl-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(3alpha,13alpha,14beta,20alpha)-13-Methyl-26-noroleana-7,9(11)-diene-3,29-diol	present	LOTUS
(S)-5-Hydroxy-7-Methoxy-8-Methyl-2-Phenylchroman-4-One	present	NPASS
1-(2-Hydroxy-4,6-dimethoxyphenyl)-3-phenyl-2-propen-1-one	present	NPASS
2',6'-Dihydroxy-3'-methyl-4'-methoxychalcone	present	NPASS
2-[(1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bS)-9-acetoxy-3a,5a,5b,8,8,11a-hexamethyl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-1-yl]allyl acetate	present	LOTUS
5,7,4'-Trihydroxy-3,8-dimethoxyflavone	present	NPASS
5,7-Dihydroxy-3-methoxy-6,8-dimethylflavone	present	NPASS
5,8-Dihydroxy-3,7-dimethoxyflavone	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichosanthes dioica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPX413483.1 ↗387 bpIndia · 2024

ACGT

ATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAGGCTCTACGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACTGCTTATATT …

Trichosanthes dioica cultivar G14 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL8★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Trichosanthes dioica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode21records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2221×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +5

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Mukherjee, P. 1975. Sex chromosome studies of certain members of the unisexual families. J. Cytol. Genet. 9–10: 42–49.

CCDB · ipcn-api-dl — SINGH, A. K. & R. P. Roy. 1979. Cytological studies in Trichosanthes L. J. Cytol. Genet. 14: 50–57.

CCDB · ipcn-api-dl — Dubey, R. 1986. Genetic studies in Trichosanthes dioica Roxb. Proc. Indian Sci. Congr. Assoc. 73(3–VI): 163.

CCDB · ipcn-api-dl — Sarkar, D. D. & K. B. Datta. 1981. Chromosomal basis of intraspecific differentiation in Trichosanthes dioica Roxb. (Cucurbitaceae). Proc. Indian Sci. Congr. Assoc. 68(10): 65.

CCDB · ipcn-api-dl — De Sarker, D. & K. B. DATTA. 1987. Giemsa C-banding pattern in some cultivars of Trichosanthes dioica Roxb. Cytologia 52: 419–423.

CCDB · ipcn-api-dl — De Sarker, D., K. B. Datta & R. Sen. 1987. Cytomorphology of some wild and cultivated members of Trichosanthes L. Cytologia 52: 405–417.

CCDB · ipcn-api-dl — Chattopadhyay, D. & A. K. Sharma. 1988. A new technique for orcein banding with acid treatment. Stain Technol. 63: 283–287.

CCDB · ipcn-api-dl — Chattopadhyay, D. & A. K. Sharma. 1991. Chromosome studies and nuclear DNA in relation to sex difference and plant habit in two species of Cucurbitaceae. Cytologia 56: 409–417.

CCDB · ipcn-api-dl — Bandey, D. B., N. Kishore & S. Dubey. 1989. Cytogenetic studies in Trichosanthes dioica Roxb. Proc. Indian Sci. Congr. Assoc. 76(3,VI): 188.

CCDB · ipcn-api-dl — Sangram, S., A. Guha & R. K. Sinha. 2003. Karyotype and sex expression in Trichosanthes dioica. Cytologia 68: 357–361.

CCDB · ipcn-api-dl — Sen, R. & K. B. DATTA. 1975a. Cytogenetical studies in cultivated Trichosanthes L. (Cucurbitaceae) and their wild relatives. Proc. Indian Sci. Congr. Assoc. 62: 62–63.

CCDB · ipcn-api-dl — Guha. 2004. Average packing ratio as a parameter for analyzing the karyotypes of dioecious cucurbits. Caryologia 57(1): 117–120.

CCDB · ipcn-api-dl — De Sarker, D. & K. B. Datta. 1988. Cytological basis of sex expression in Trichosanthes L. Cytologia 53: 475–483.

CCDB · book-ipcn75-78 — Sen & Datta 1975a

CCDB · book-indian_vol1 — Das, M.C. 1933 ; Bhaduri, P.N. & Bose, P.C. 1947 ; Patel, G.I. 1952

CCDB · book-fedorov — Bhaduri, Bose 1947

CCDB · book-fedorov — Patel G. l. 1952

CCDB · book-atlas-flowering-plants — Bhaduri & B. 1947

CCDB · kew — Chattopadhyay D, Sharma AK. 1991. Chromosome studies and nuclear DNA in relation to sex difference and plant habit in two species of Cucurbitaceae. Cytologia 56: 409-417.

TreeOfSex · plant — Goldblatt1979 ↗

n 114×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · TreeOfSex · plant

CCDB · ipcn-api-dl — Sen, R. & K. B. DATTA. 1975a. Cytogenetical studies in cultivated Trichosanthes L. (Cucurbitaceae) and their wild relatives. Proc. Indian Sci. Congr. Assoc. 62: 62–63.

CCDB · ipcn-api-dl — De Sarker, D. & K. B. Datta. 1988. Cytological basis of sex expression in Trichosanthes L. Cytologia 53: 475–483.

CCDB · book-ipcn75-78 — Sen & Datta 1975a

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type30 records

Wild obs. + sensor18

Museum / vouchered7

Other5

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 3>10 km 1

8 georeferenced · 10 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	1
University of Stellenboschlocation not on record	1

2 institutions · 2 of 7 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Trichosanthes dioica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 14.8–14.8

Seasonal swing summer↔winter14.1 °C

Max temp (day)17.9 °C

Min temp (night)9.30 °C

Precipitation297 mm/mo

Air humidity63.1 %

Moisture balance218 mm/mo

Vapour deficit617 Pa

Wind speed1.10 m/s

Cloud cover29.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)