Trichosalpinx orbicularis

(Lindl.) Luer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Trichosalpinx

At a glance

Occurrence records158

Data sources7

Biological traits17

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Trichosalpinx orbicularis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility158 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF158 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Trichosalpinx orbicularis is a species of orchid found from Trinidad to Central America and southern tropical America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 500 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: E

Habitat GIFTCampinarana, Floresta de Igapó, Floresta de Terra Firme, Floresta de Várzea, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio51.35 g/g

Leaf c457 mg/g

Leaf dry-matter content (LDMC)144 mg/g

Leaf n8.97 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)8.29 mm²/mg

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichosalpinx orbicularis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY988989.1 ↗729 bp

ACGT

GTGACTCTGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA …

Trichosalpinx orbicularis voucher AR6474 (USJ) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★rbcLa★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type158 records

Wild obs. + sensor48

Museum / vouchered108

Cultivated / captive2

Origin

Native1

Range

Area of Occupancy AOO424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 11≤1 km 2≤10 km 12>10 km 7

32 georeferenced · 16 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 2≤1 km 3≤10 km 3>10 km 8

16 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence108

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	25
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	7
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	7
Universidad Nacional de Colombia (UNAL)location not on record	7
National Biodiversity Institute, Costa Ricalocation not on record	5
QCNElocation not on record	5
St. Augustine, TT	5
South Kensington, GB	5
Anton de Kom University of Surinamelocation not on record	4
Museo Nacional de Costa Rica (MNCR)location not on record	3
Station d'Ecologie de Lamtolocation not on record	3
Pontificia Universidad Javeriana (PUJ)location not on record	3
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellín (JBM)location not on record	3
Durham, US	2
Paris, FR	1
Institut de Recherche pour le Developpement (IRD)location not on record	1
Kew, GB	1
Bronx, US	1
INMAlocation not on record	1
San José, CR	1
León, NI	1
Universidad de Antioquia (UdeA)location not on record	1
University of Stellenboschlocation not on record	1
BGBMlocation not on record	1
Quito, EC	1
Cambridge, US	1

26 institutions · 96 of 108 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Trichosalpinx orbicularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)