Trichosalpinx montana — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Trichosalpinx

At a glance

Occurrence records11

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Trichosalpinx montana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF11 records

DNA & barcodingNCBIsequences

01Narrative

Trichosalpinx montana is a species of orchid native to eastern and southern Brazil. The Latin specific epithet montana refers to mountains or coming from mountains.Archibald William Smith

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Elevation max1 000 m

Elevation min500 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichosalpinx montana has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN551480.1 ↗745 bpBrazil

ACGT

TTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGATCGAAATATAT …

Trichosalpinx montana isolate T2909 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type11 records

Museum / vouchered11

Origin

Native5

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence11

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	8
Alicante, ES	1
INMAlocation not on record	1

3 institutions · 10 of 11 vouchered records shown · 1 without an institution code