Trichophyton violaceum

Sabour. ex E.Bodin · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Onygenales/Arthrodermataceae/Trichophyton

At a glance

Occurrence records8

Data sources9

Biological traits0

DNA specimens55

eDNA detections45

Sources9 archives

Databases and archives Trichophyton violaceum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF8 records

Environmental DNA3 datasets · 2 countries45 detections

DNA & barcodingBOLD · NCBI55 specimens

Genome at a glanceGoaT · NCBI≈24 Mbp

01Narrative

Trichophton violaceum est une espèce de champignons de la famille des Arthrodermataceae. C’est un des champignons responsables de la teigne.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition3 compounds

Compounds documented for Trichophyton violaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Bisnaphthalenes2

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(3R)-6-hydroxy-8-[(3R)-6-hydroxy-9-methoxy-3-methyl-1,7,10-trioxo-3,4-dihydrobenzo[h]isochromen-8-yl]-9-methoxy-3-methyl-3,4-dihydrobenzo[h]isochromene-1,7,10-trione	present	LOTUS
[(7S,20S)-14,24-diacetyloxy-28-methoxy-7,20-dimethyl-9,13,22,26-tetraoxo-8,16,21-trioxaheptacyclo[15.11.1.02,15.03,12.05,10.018,23.025,29]nonacosa-1,3(12),4,10,14,17(29),18(23),24,27-nonaen-11-yl] acetate	present	LOTUS
Vioxanthin	present	LOTUS

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichophyton violaceum has left across the world's sequence archives.

At a glance

DNA specimens55

Marker genes5

GenBank sequences10

eDNA detections45

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPV491999.1 ↗494 bpChina · 2021

ACGT

GGCCGTACGCCCCCATTCTTGTCTACCTCACCCGGTTGCCTCGGCGGGCCGCGCTCCCCCTGCCAGGGAGAGCCGTCCGGCGGGCCCCTT …

Trichophyton violaceum isolate JYP21055 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Trichophyton violaceum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈24 319 137 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Trichophyton violaceum0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

10Collections & institutions

Institution	Specimens
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	2
Sydney Medical Schoollocation not on record	1

2 institutions · 3 of 8 vouchered records shown · 4 without an institution code

09Environmental DNA45 detections

Where the DNA of Trichophyton violaceum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys3

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 17.4–21.2

Seasonal swing summer↔winter17.5 °C

Max temp (day)21.7 °C 19.5–26.7

Min temp (night)14.7 °C 14.5–15.3

Precipitation32.3 mm/mo 27.0–48.4

Air humidity56.1 % 47.1–60.8

Moisture balance-93.7 mm/mo -122–-64.2

Vapour deficit1,032 Pa 840–1,473

Wind speed3.80 m/s 3.20–4.00

Cloud cover33.4 % 23.5–36.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)