Trichophyton schoenleinii

(Lebert) Langeron & Miloch. ex Nann. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Onygenales/Arthrodermataceae/Trichophyton

At a glance

Occurrence records4

Data sources10

Biological traits0

DNA specimens28

eDNA detections18

Sources10 archives

Databases and archives Trichophyton schoenleinii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 records

Environmental DNA3 datasets · 4 countries18 detections

DNA & barcodingBOLD · NCBI28 specimens

Genome at a glanceGoaT · NCBI≈24 Mbp

01Narrative

Trichophyton schoenleinii ist ein die Hornsubstanz besiedelnder Hautpilz, der primär den Menschen befällt (anthropophiler Dermatophyt). Die Teleomorphe ist unbekannt. Er wurde von Robert Remak auf Anregung von Johann Lukas Schönlein als Auslöser des Erbgrinds identifiziert. Das Myzel verleiht befallenen Haaren aufgrund des „Hohlraumeffekts“ dunkle Abschnitte, so dass sie schwarz bebändert aussehen. Es kommt im Regelfall nicht zum Abbrechen des Haars.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichophyton schoenleinii has left across the world's sequence archives.

At a glance

DNA specimens28

Marker genes5

GenBank sequences10

eDNA detections18

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPV171644.1 ↗495 bpChina · 2023

ACGT

GGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCTCTCAGGAGAGCCGTTCGGCGAGCCTCTCTTT …

Trichophyton schoenleinii strain 11325 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_082837 ↗ · 15 protein · 25 tRNA · 2 rRNA

nad4atp6nad6cox3atp8rps5cox1atp9cox2nad4lnad5nad2cobnad3nad1rrnSrrnL

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Trichophyton schoenleinii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈23 674 609 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Trichophyton schoenleinii0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.9% BUSCO

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

10Collections & institutions

Institution	Specimens
Scientific Institute of Public Health, Brusselslocation not on record	3
Sydney Medical Schoollocation not on record	1

2 institutions · 4 of 4 vouchered records shown

09Environmental DNA18 detections

Where the DNA of Trichophyton schoenleinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys3

Countries4

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 11.7–18.5

Seasonal swing summer↔winter13.2 °C

Max temp (day)21.2 °C 15.5–23.0

Min temp (night)12.1 °C 7.90–13.8

Precipitation57.4 mm/mo 38.0–69.4

Air humidity60.5 % 57.1–63.2

Moisture balance-49.8 mm/mo -73.6–-11.4

Vapour deficit800 Pa 582–896

Wind speed3.00 m/s 2.20–3.80

Cloud cover28.2 % 20.2–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)