Trichophyton ajelloi

(Vanbreus.) Ajello · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Onygenales/Arthrodermataceae/Trichophyton

At a glance

Occurrence records13

Data sources8

Biological traits0

DNA specimens1

eDNA detections51

Sources8 archives

Databases and archives Trichophyton ajelloi's data was compiled from.

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF13 records

Environmental DNA7 datasets · 9 countries51 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT · NCBI≈24 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichophyton ajelloi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections51

Countries9

The DNA barcodea real sequence read deposited for this species

ITSMH858408.1 ↗583 bpCzechoslovakia

ACGT

ATCATTAAAGCGCCGCCGACGTCGACCCCGGCCGCCCGGCTTGAGATATAGCCCGGGCGGTGCTGGAGGTCGCCGGCAGTTGCCCATTCT …

Arthroderma uncinatum strain CBS 180.64 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Trichophyton ajelloi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈23 598 465 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Trichophyton ajelloi0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness97.6% BUSCO

08Occurrence & distribution

Record type13 records

Museum / vouchered11

Other2

Range

Area of Occupancy AOO32 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	1

1 institutions · 1 of 11 vouchered records shown · 10 without an institution code

09Environmental DNA51 detections

Where the DNA of Trichophyton ajelloi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys7

Countries9

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.0 °C 13.0–25.0

pH6.10 5.50–6.90

Conductivity118 µS/cm 85.0–217

Organic carbon3.36 % 2.44–4.39

Nitrate-N12.0 mg/kg 2.00–59.0

Phosphorus98.0 mg/kg 26.0–200

Clay21.2 % 11.7–30.1

Sand67.8 % 55.8–80.2

Depth0 m

MarineSoilSodosolVertosolChromosol

8 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 8.50–14.9

Seasonal swing summer↔winter8.50 °C

Max temp (day)16.6 °C 11.9–19.3

Min temp (night)8.60 °C 5.20–10.1

Precipitation55.7 mm/mo 51.0–72.3

Air humidity57.4 % 56.1–62.3

Moisture balance-67.3 mm/mo -67.4–3.90

Vapour deficit622 Pa 462–784

Wind speed4.00 m/s 2.80–5.40

Cloud cover40.0 % 18.5–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)