Trichophorum cespitosum
(L.) Hartm. · speciesAt a glance
Occurrence records125 099
Data sources11
Biological traits115
DNA specimens88
eDNA detections49
Sources11 archives
Databases and archives Trichophorum cespitosum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility125 099 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics88 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources115 traits
Chemical compositionLOTUS15 compounds
Occurrence & distributionGBIF125 099 records
Environmental DNA1 datasets · 7 countries49 detections
DNA & barcodingBOLD · NCBI88 specimens
Genome at a glanceCCDB · GoaT · NCBI≈318 Mbp
01Narrative
Trichophorum cespitosum, le scirpe cespiteux, trichophore cespiteux ou encore souchet cespiteux, est une espèce de plante herbacée vivace de la famille des Cyperaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRYUSDA
Size & morphology9
Leaf size271 mm²
Plant height0.396 m
⚠ sources differ — USDA: 0.396 m · TRY: 0.233 m
Plant height generative0.17 m
Plant height max0.4 m
Plant height min0.05 m
Seed length1.84 mm
Seed mass0.36 mg
Seed mass max0.49 mg
Seed mass min0.238 mg
Life cycle & reproduction34
After harvest regrowth rateSlow
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessn.d.
Dehiscenceindehiscent
Dispersal typewind
Flower colouryellow
Flower conspicuousNo
Flowering endJul
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Vegetative spread rateModerate
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment27
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Growth form USDARhizomatous
Habitat GIFTswamps, tundra
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typeAMNM
Root depth min10 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry22
Anaerobic toleranceHigh
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min80 days
Leaf n15.3 mg/g
Leaf p1.1 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min12 in
Salinity toleranceNone
Shade toleranceMedium
Soil pH max6.5 pH
Soil pH min4.5 pH
Specific leaf area (SLA)8.26 mm²/mg
Temperature min-43 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Diaspore typefruit
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min1 700 per acre
03Chemical composition15 compounds
Compounds documented for Trichophorum cespitosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Flavones12
Flavonols3
Documented compounds15 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 5,4'-Dihydroxy-7,3'-dimethoxyflavone | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-8-[(2S,3S,4R,5S)-3,4,5-trihydroxyoxan-2-yl]chromen-4-one | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-8-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-6-[(2S,3S,4R,5S)-3,4,5-trihydroxyoxan-2-yl]chromen-4-one | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxyphenyl)-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-8-[(2S,3S,4R,5S)-3,4,5-trihydroxyoxan-2-yl]chromen-4-one | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxyphenyl)-8-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-6-[(2R,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]chromen-4-one | present | LOTUS | |
| Chrysoeriol | present | LOTUS | |
| Isorhamnetin 3-galactoside | present | LOTUS | |
| Isoscoparin | present | LOTUS | |
| Jaranol | present | LOTUS | |
| Neoschaftoside | present | LOTUS |
05DNA & barcoding88 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichophorum cespitosum has left across the world's sequence archives.
At a glance
DNA specimens88
Marker genes6
GenBank sequences10
eDNA detections49
Countries7
The DNA barcodea real sequence read deposited for this species
TCGTTGCCTTTGAAGAACACGATCGGTGCACACGTGATAGAATGCTGTCGGGGAGGCACTGCCTCCTCGGCCCCACCGGCCCCGACCCTC …
Trichophorum cespitosum isolate STA2613 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL1★rbcLa★ITS6★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Trichophorum cespitosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈317 897 495 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trichophorum cespitosum0.32 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 104 n = 52
Ploidypolyploid inferred
Chromosome records104–1042n range104median104mode23records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 10423×CCDB · nw-europe-fl · CCDB · fl-europaea · CCDB · book-ipcn65 +7
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4289
CCDB · fl-europaea — Scheerer, 1940
CCDB · book-ipcn65 — Love & Love 1965a
CCDB · cyper-only — 409Jorgensen, C. A., T. Sorensen & M. Westergaard1958
CCDB · cyper-only — 410Lve, . & D. Lve1965c
CCDB · cyper-only — 411Lve, . & D. Lve1965c
CCDB · cyper-only — 412Lve, . & D. Lve1966
CCDB · cyper-only — Zhukova, P. G. & V. V. Petrovsky1975
CCDB · cyper-only — Zhukova, P. G.1980
CCDB · cyper-only — 412Lve, . & D. Lve1981
CCDB · cyper-only — 412Zhukova, P. G.1982
CCDB · cyper-only — 412Yurtsev, B. A. & P. G. Zhukova1982
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1975. Chromosome numbers of some Western Chukolka plant species. Bot. Žhurn. (Moscow & Leningrad) 60(3): 395–401.
CCDB · book-ipcn66 — Love & Love 1966b
CCDB · eflora
CCDB · book-fedorov — Love A., Love D. 1956b, 1961b
CCDB · book-atlas-flowering-plants — Scheerer 1940
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1956b). Cytotaxonomical conspectus of the Icelandic flora. Acta Horti Gothob. 20(4): 65-291.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1961a). Chromosome numbers of central and north-west European plant species. Opera Bot. 5: 1-581.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness81.6% BUSCO
08Occurrence & distribution
Record type125 099 records
Wild obs. + sensor121 385
Museum / vouchered3 654
Cultivated / captive8
Other52
Origin
Native15 478
Range
Area of Occupancy AOO157 696 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy52% within 1 km
≤100 m 31 670≤1 km 25 824≤10 km 53 524>10 km 377
111 395 georeferenced · 9 990 without coordinates
Open the mapobservation + sensor121 385
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy36% within 1 km
≤100 m 231≤1 km 569≤10 km 892>10 km 548
2 240 georeferenced · 1 414 without coordinates
Open the institutions mapphysical evidence3 654
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 3
3 georeferenced · 5 without coordinates
Open the mapnot free-living8
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions80 of 165 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 456 |
| Moscow State Universitylocation not on record | 188 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 169 |
| Oulu, FI | 145 |
| Salzburg, AT | 134 |
| MeiseBGlocation not on record | 130 |
| BFLlocation not on record | 119 |
| Tartu, EE | 91 |
| TROMlocation not on record | 88 |
| University of Stellenboschlocation not on record | 81 |
| Turku, FI | 79 |
| Brussel, BE | 75 |
| BRNUlocation not on record | 71 |
| Toronto, CA | 71 |
| Ann Arbor, US | 69 |
| WINlocation not on record | 63 |
| University of Alberta Museumslocation not on record | 62 |
| Québec, CA | 58 |
| Trondheim, NO | 57 |
| Olocation not on record | 56 |
| Uniwersytet Wrocławskilocation not on record | 55 |
| Chongqing Museumlocation not on record | 55 |
| Montréal, CA | 49 |
| SLU Artdatabankenlocation not on record | 43 |
| Victoria, CA | 36 |
| MAlocation not on record | 35 |
| Montréal, CA | 35 |
| Oskarshamn, SE | 34 |
| Uppsala, SE | 33 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 33 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 28 |
| JP | 26 |
| Jyväskylä, FI | 25 |
| University of New Hampshirelocation not on record | 23 |
| Bern, CH | 22 |
| Université Lavallocation not on record | 21 |
| Toyama, JP | 21 |
| BSBIlocation not on record | 19 |
| Philadelphia, US | 19 |
| CJBGlocation not on record | 19 |
| Provincia di Livornolocation not on record | 18 |
| Mlocation not on record | 17 |
| Philadelphia, US | 17 |
| KMNlocation not on record | 16 |
| LDlocation not on record | 16 |
| Pullman, US | 15 |
| Tallinn, EE | 14 |
| Irkutsk State Universitylocation not on record | 14 |
| Vancouver, CA | 13 |
| Corvallis, US | 13 |
| Auckland, NZ | 12 |
| Kuopio, FI | 12 |
| University of Birminghamlocation not on record | 12 |
| Bergen, NO | 12 |
| Missoula, US | 11 |
| Glarus, CH | 11 |
| Görlitz, DE | 11 |
| Wuzhou, CN | 11 |
| WTUlocation not on record | 10 |
| Dresden, DE | 10 |
| GZUlocation not on record | 10 |
| Wlocation not on record | 10 |
| Berlin, DE | 9 |
| Bloomington, US | 9 |
| Zürich, CH | 8 |
| Shinshu Universitylocation not on record | 8 |
| DBF-NHMDlocation not on record | 8 |
| GJOlocation not on record | 8 |
| Tromso University Museumlocation not on record | 7 |
| TUR-Alocation not on record | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Rovaniemi, FI | 6 |
| Zürich, CH | 6 |
| Sion, CH | 6 |
| Tampa, US | 6 |
| Porrentruy, CH | 6 |
| BClocation not on record | 6 |
| SZUlocation not on record | 6 |
| Stockholm, SE | 5 |
| Institute of the biological problems of the North FEB RASlocation not on record | 5 |
| Metsähallituslocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Porvoo, FI | 5 |
| Canadian Museum of Naturelocation not on record | 5 |
| Tomioka, JP | 5 |
| Durham, US | 4 |
| Hokkaido University Museumlocation not on record | 4 |
| Forssa, FI | 4 |
| Karlsruhe, DE | 4 |
| Bourges, FR | 4 |
| Portland, US | 4 |
| PRClocation not on record | 4 |
| LfUlocation not on record | 4 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 4 |
| Anchorage, US | 4 |
| South Kensington, GB | 4 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 3 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 3 |
| Royal British Columbia Museumlocation not on record | 3 |
| Hokkaido University Botanic Gardenlocation not on record | 3 |
| Lausanne, CH | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Christchurch, NZ | 3 |
| US | 3 |
| Green Bay, US | 3 |
| Kew, GB | 3 |
| Frankfurt am Main | 3 |
| Yukon Universitylocation not on record | 3 |
| Sendai, JP | 3 |
| Tsukuba, JP | 3 |
| Paris, FR | 3 |
| John May Museum of Natural Historylocation not on record | 2 |
| Churchill Northern Studies Centrelocation not on record | 2 |
| Saint John, CA | 2 |
| Burlington, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| València, ES | 2 |
| National Museum Waleslocation not on record | 2 |
| Logan, US | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Nijmegen, NL | 2 |
| Flagstaff, US | 2 |
| Columbia, US | 2 |
| IWEP FEB RASlocation not on record | 2 |
| nbflocation not on record | 2 |
| University of Hamburglocation not on record | 2 |
| Mexico City, MX | 1 |
| Granada, ES | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Nagano City, JP | 1 |
| McWane Science Centerlocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Göteborg, SE | 1 |
| SIHUlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Pamplona, ES | 1 |
| Acadia Universitylocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| National Botanic Gardens of Irelandlocation not on record | 1 |
| NoColllocation not on record | 1 |
| Saint Louis, US | 1 |
| Oswego, US | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Tacoma, US | 1 |
| GAlocation not on record | 1 |
| HJAEFlocation not on record | 1 |
| Elocation not on record | 1 |
| San Angelo, US | 1 |
| Wellington, NZ | 1 |
| Xiamen, CN | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Whitewater, US | 1 |
| McGill University, Department of Biologylocation not on record | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| PTHlocation not on record | 1 |
| Sunderland Museumlocation not on record | 1 |
| McGill Universitylocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Provo, US | 1 |
| CICYTEXlocation not on record | 1 |
| University of Hulllocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
165 institutions · 3 488 of 3 654 vouchered records shown · 140 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA49 detections
Where the DNA of Trichophorum cespitosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found49
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 49 detections have coordinates
Open the map7 countries0
blanket bog; bedrockon cliff ledge
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.8 °C 6.00–17.0
Seasonal swing summer↔winter17.4 °C
Max temp (day)14.7 °C 9.90–19.9
Min temp (night)8.40 °C 2.80–13.5
Precipitation75.2 mm/mo 54.1–119
Air humidity63.3 % 59.2–65.9
Moisture balance-1.80 mm/mo
Vapour deficit486 Pa 370–715
Wind speed4.40 m/s
Cloud cover51.3 % 36.1–64.5
CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.