Tricholoma aestuans

(Fr.) Gillet · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Tricholomataceae/Tricholoma

At a glance

Occurrence records1 512

Data sources9

Biological traits0

DNA specimens16

eDNA detections32

Sources9 archives

Databases and archives Tricholoma aestuans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 512 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 512 records

Environmental DNA2 datasets · 5 countries32 detections

DNA & barcodingBOLD · NCBI16 specimens

01Narrative

Tricholoma aestuans is a mushroom of the agaric genus Tricholoma. First described formally by Elias Magnus Fries in 1821, it was transferred to the genus Tricholoma by Claude Casimir Gillet in 1874.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tricholoma aestuans has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes2

GenBank sequences9

eDNA detections32

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMN809128.1 ↗601 bpUSA · 2019

ACGT

GGGGAATGTCCACACCTGACACCAACTTTTTCTTACCACCTGTGCACTTTTTGTAGATTTGGAATAACCTTGCGAGGAAACTCGGTTTGA …

Tricholoma aestuans bio-material iNAT:36230152 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type1 512 records

Wild obs. + sensor1 195

Museum / vouchered317

Range

Area of Occupancy AOO4 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 643≤1 km 391≤10 km 121>10 km 3

1 158 georeferenced · 37 without coordinates

Open the mapobservation + sensor1 195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 36≤1 km 92≤10 km 35>10 km 22

185 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence317

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	71
Olocation not on record	54
Joensuu, FI	23
Uppsala, SE	17
Davis and Elkins Collegelocation not on record	9
Göteborg, SE	8
SLU Artdatabankenlocation not on record	8
Philadelphia, US	8
Université de Montréal Biodiversity Centrelocation not on record	7
Kuopio, FI	6
Trondheim, NO	6
Chicago, US	6
WU-MYClocation not on record	6
Karlsruhe, DE	5
Turku, FI	5
nsnflocation not on record	4
Colorado State Universitylocation not on record	4
TROMlocation not on record	4
University of Oslo, Natural History Museumlocation not on record	3
Toronto, CA	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Personal Herbarium of Renee LeBeuflocation not on record	3
Jyväskylä, FI	2
Rene Pomerleau Herbariumlocation not on record	2
Tomioka, JP	2
LDlocation not on record	2
TUR-Alocation not on record	1
Görlitz, DE	1
Bronx, US	1
Personal Collection of Herman Lambertlocation not on record	1
Personal Herbarium of Igor Safonovlocation not on record	1
National Biodiversity Institute, Costa Ricalocation not on record	1
TENN-Flocation not on record	1
Copenhagen, DK	1
Tartu, EE	1
ILLSlocation not on record	1
GJOlocation not on record	1
Durham, US	1
Ann Arbor, US	1

39 institutions · 284 of 317 vouchered records shown · 32 without an institution code

09Environmental DNA32 detections

Where the DNA of Tricholoma aestuans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map5 countries0

Lavdominert sandfuruskog

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C 6.70–17.6

Seasonal swing summer↔winter24.1 °C

Max temp (day)13.4 °C 9.70–21.5

Min temp (night)5.80 °C 3.30–13.5

Precipitation83.7 mm/mo 76.3–158

Air humidity61.7 % 60.2–65.7

Moisture balance49.1 mm/mo -43.5–80.0

Vapour deficit485 Pa 342–795

Wind speed2.70 m/s 2.40–3.70

Cloud cover53.7 % 39.0–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tricholoma aestuans

At a glance

Sources9 archives

At a glance

Record type1 512 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 512 records