Trichodiadema occidentale

L.Bolus · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Trichodiadema

At a glance

Occurrence records71

Data sources4

Biological traits11

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Trichodiadema occidentale's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility71 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF71 records

DNA & barcodingNCBIsequences

01Narrative

Trichodiadema occidentale is succulent plant of the genus Trichodiadema, native to the Western Cape Province, South Africa, where it grows in rocky shale or limestone hills in the Overberg region, and especially in disturbed areas. It occurs throughout the Overberg region, from Caledon in the west, south to Agulhas and Bredasdorp, and eastwards to Swellendam and Riversdale.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.01 m

Life cycle & reproduction2

Life formsucculent tuberous subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max365 m

Elevation min50 m

Epiphyteterrestrial

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichodiadema occidentale has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLR031036.1 ↗611 bpSouth Africa

ACGT

TCATTGTCGAAAACTGCCATGCAGAACGACCCGTGAACACGTTTAAACACATGGGAGGGACGCATGCGGCCTCGCGCCGCCTGCCCCCTC …

Trichodiadema occidentale genomic DNA sequence contains ITS1, 5.8S rRNA gene, ITS2, specimen voucher HBG: Hartmann et Bayer 34639

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type71 records

Wild obs. + sensor68

Museum / vouchered3

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 42≤1 km 3>10 km 7

52 georeferenced · 16 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	3

1 institutions · 3 of 3 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)