Trichodiadema mirabile — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Trichodiadema

At a glance

Occurrence records53

Data sources4

Biological traits12

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Trichodiadema mirabile's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility53 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF53 records

DNA & barcodingNCBIsequences

01Narrative

Trichodiadema mirabile is succulent plant of the genus Trichodiadema, native to the Western Cape Province, South Africa, where it is known from the Laingsburg area and especially from south-facing slopes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.07 m

Plant height min0.02 m

Life cycle & reproduction2

Life formsucculent tuberous subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 200 m

Elevation min750 m

Epiphyteterrestrial

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichodiadema mirabile has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLR031034.1 ↗610 bpSouth Africa

ACGT

TCATTGTCGAAAACTGCCATGCAGAACGACCCGTGAACACGTTTAAACACATGGGAGGGACGCATGCGGCCTCGCGCTGCCTGCCCCCTC …

Trichodiadema mirabile genomic DNA sequence contains ITS1, 5.8S rRNA gene, ITS2, specimen voucher HBG: Hartmann 30322

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor36

Museum / vouchered17

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 24≤1 km 5≤10 km 1>10 km 6

36 georeferenced

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	8
Cape Town, ZA	5
University of Hamburglocation not on record	4

3 institutions · 17 of 17 vouchered records shown