Trichodiadema barbatum

(L.) Schwantes · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Trichodiadema

At a glance

Occurrence records59

Data sources8

Biological traits12

DNA specimens3

eDNA detections2

Sources8 archives

Databases and archives Trichodiadema barbatum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF59 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Trichodiadema barbatum is succulent plant of the genus Trichodiadema, native to the Eastern Cape Province, South Africa.SANBI Red List page

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.15 m

Life cycle & reproduction2

Life formsucculent tuberous subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min250 m

Epiphyteterrestrial

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichodiadema barbatum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAY046587.1 ↗1 386 bp

ACGT

GCTGGCGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATAAACCTCAGGATACTGATATCTTGGCAGCATTCCGAGTATCTCCC …

Trichodiadema barbatum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Trichodiadema barbatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Snoad 1951

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type59 records

Wild obs. + sensor38

Museum / vouchered21

Origin

Introduced2

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 11≤1 km 9>10 km 10

30 georeferenced · 8 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	9
Cape Town, ZA	7
Cape Town, ZA	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1

4 institutions · 18 of 21 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Trichodiadema barbatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)