Trichodesma scottii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Trichodesma

At a glance

Occurrence records15

Data sources5

Biological traits6

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Trichodesma scottii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF15 records

DNA & barcodingNCBIsequences

01Narrative

Trichodesma scottii là một loài thực vật thuộc họ Boraginaceae. Đây là loài đặc hữu của Yemen. Môi trường sống tự nhiên của chúng là rừng khô nhiệt đới hoặc cận nhiệt đới và vùng cây bụi khô khu vực nhiệt đới hoặc cận nhiệt đới.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climateseasonally dry tropical

Growth formtree

Woodinessvariable

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichodesma scottii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSKF288022.1 ↗462 bp

ACGT

ATCCGCATTAGTGTCATTTGACTCTGTGCTTAACAAACCCCCGGCGCGAGAAGCGCCAAGGAATACTCTAACAAGGGCTTGATTCATCCT …

Trichodesma scotti internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor6

Museum / vouchered9

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	4
Kew, GB	2
Stockholm, SE	1
Wlocation not on record	1
Edinburgh, GB	1

5 institutions · 9 of 9 vouchered records shown