Trichoderma reesei

E.G.Simmons · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Hypocreaceae/Trichoderma

At a glance

Occurrence records306

Data sources11

Biological traits0

DNA specimens52

eDNA detections51

Sources11 archives

Databases and archives Trichoderma reesei's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility306 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS53 compounds

Occurrence & distributionGBIF306 records

Environmental DNA3 datasets · 6 countries51 detections

DNA & barcodingBOLD · NCBI52 specimens

Genome at a glanceGoaT · NCBI33 Mbp

01Narrative

Trichoderma reeseiSimmons EG (1977) in Bigelow & Simmons, Abstracts, 2nd International Mycological Congress (Tampa) 2: 618. is a mesophilic and filamentous fungus. It is an anamorph of the fungus Hypocrea jecorina. T. reesei can secrete large amounts of cellulolytic enzymes (cellulases and hemicellulases). Microbial cellulases have industrial application in the conversion of cellulose, a major component of plant biomass, into glucose. T. reesei isolate QM6a was originally isolated from the Solomon Islands during World War II because of its degradation of canvas and garments of the US army. All strains currently used in biotechnology and basic research were derived from this isolate. Recent advances in the biochemistry of cellulase enzymology, the mechanism of cellulose hydrolysis (cellulolysis), strain improvement, molecular cloning and process engineering are bringing T. reesei cellulases closer to being a commercially viable route to cellulose hydrolysis. Several industrially useful strains have been developed and characterised, e.g. Rut-C30, RL-P37 and MCG-80. The genome was released in 2008. T. reesei has a mating type-dependent characterised sexual cycle.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition53 compounds

Compounds documented for Trichoderma reesei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Sorbicilinoids68

Carboline alkaloids2

Catechols with side chains $ Sorbicilinoids2

p-Terphenyls1

Peptaibols1

Documented compounds53 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,6S,7S,8S,11Z)-8-hydroxy-11-[(2E,4E)-1-hydroxyhexa-2,4-dienylidene]-1,3,8-trimethyl-3-azatricyclo[5.2.2.02,6]undecane-4,9,10-trione	present	LOTUS
(2E,4E)-1-(2,4-dihydroxy-3,5-dimethylphenyl)-6-hydroxyhexa-2,4-dien-1-one	present	LOTUS
(2e,4e)-1-(2,6-Dihydroxy-3,5-dimethyl-phenyl)hexa-2,4-dien-1-one	present	LOTUS
(2R)-7-hydroxy-2-(3-hydroxypropyl)-6,8-dimethyl-2,3-dihydrochromen-4-one	present	LOTUS
(E)-1-(2,4-dihydroxy-3,5-dimethylphenyl)-6-hydroxyhex-4-en-1-one	present	LOTUS
(E)-6-(2,4-dihydroxyl-5-methylphenyl)-6-oxo-2-hexenoic acid	present	LOTUS
(E)-6-hydroxy-1-(2,4,5-trihydroxy-3-methylphenyl)hex-4-en-1-one	present	LOTUS
1-(2,4-Dihydroxy-3,5-dimethylphenyl)-3,4,5-trihydroxyhexan-1-one	present	LOTUS
1-(2,4-dihydroxy-3-methylphenyl)-2-[(2S,5R)-5-[(1S)-1-hydroxyethyl]oxolan-2-yl]ethanone	present	LOTUS
1-(2,4-Dihydroxy-5-methylphenyl)-6-hydroxyhex-4-en-1-one	present	LOTUS

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichoderma reesei has left across the world's sequence archives.

At a glance

DNA specimens52

Marker genes3

GenBank sequences10

eDNA detections51

Countries14

The DNA barcodea real sequence read deposited for this species

ITSPX990083.1 ↗480 bpPeru · 2024

ACGT

ACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGG …

Trichoderma reesei isolate HWSC26 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Trichoderma reesei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size33 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Trichoderma reesei0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

07Deep time~27.4 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin27.4 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type306 records

Wild obs. + sensor3

Museum / vouchered302

Cultivated / captive1

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 300 without coordinates

Open the institutions mapphysical evidence302

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Corporación Centro de Investigación en Palma de Aceite (CENIPALMA)location not on record	2
UAclocation not on record	1
ILLSlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
WU-MYClocation not on record	1

5 institutions · 6 of 302 vouchered records shown · 291 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA51 detections

Where the DNA of Trichoderma reesei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys3

Countries6

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map6 countries0

Afrotropicfruit body

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 17.6–28.2

Seasonal swing summer↔winter5.40 °C

Max temp (day)30.5 °C 20.3–32.1

Min temp (night)21.4 °C 15.8–24.5

Precipitation139 mm/mo 70.3–374

Air humidity62.7 % 56.7–71.5

Moisture balance220 mm/mo

Vapour deficit1,225 Pa 566–1,560

Wind speed2.20 m/s

Cloud cover26.3 % 20.0–56.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)