Trichoderma koningii

Oudem. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Hypocreaceae/Trichoderma

At a glance

Occurrence records155

Data sources13

Biological traits0

DNA specimens77

eDNA detections102

Sources13 archives

Databases and archives Trichoderma koningii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

OBISOcean Biodiversity Information System11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI102 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS76 compounds

Occurrence & distributionGBIF · OBIS155 records

Environmental DNA5 datasets · 25 countries102 detections

DNA & barcodingBOLD · NCBI77 specimens

Genome at a glanceGoaT · NCBI≈37 Mbp

01Narrative

Trichoderma koningii is a very common soil dwelling saprotroph with a worldwide distribution. It has been heavily exploited for agricultural use as an effective biopesticide, having been frequently cited as an alternative biological control agent in the regulation of fungi-induced plant diseases. They are endosymbionts associated with plant root tissues, exhibiting mycoparasitism and promoting plant growth due to their capacity to produce different secondary metabolites. Trichoderma koningii is a species belonging to the genus Trichoderma. Fungi in this genus are able to adapt to different ecological niches and can colonize their habitats effectively, allowing them to be powerful antagonists and biocontrol agents. Typical of Trichoderma species is having a fast growth rate and the production of green or hyaline conidia on a branched conidiophore structure.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition76 compounds

Compounds documented for Trichoderma koningii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Peptaibols10

Taxane diterpenoids7

Miscellaneous meroterpenoids4

Cyclonerane sesquiterpenoids3

Furans3

Documented compounds76 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,4S,6R,9R,10S)-10-hexyl-11,12-dioxatricyclo[7.2.1.01,6]dodecane-2,4-diol	present	LOTUS
(1R,2R,5S,6R,9R,10R)-10-hexyl-11,12-dioxatricyclo[7.2.1.01,6]dodecane-2,5-diol	present	LOTUS
(1R,2R,5S,7R,9S,10R,15R,16S)-15-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-5,10-dihydroxy-2-methyl-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadec-11-ene-16-carboxylic acid	present	LOTUS
(1R,2R,5S,7R,9S,10R,15R,16S)-5-[(2R,3S)-2-amino-4-methyl-3-sulfooxypentoxy]-15-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-10-hydroxy-2-methyl-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadec-11-ene-16-carboxylic acid	present	LOTUS
(1R,2S,3R)-3-[(2S)-2-hydroxy-6-methylhept-5-en-2-yl]-1,2-dimethylcyclopentan-1-ol	present	LOTUS
(1R,2S,5R,6R,9S,10S)-10-hexyl-11,12-dioxatricyclo[7.2.1.01,6]dodecane-2,5-diol	present	LOTUS
(1S,2R,4R,6S,9S,10S)-10-hexyl-11,12-dioxatricyclo[7.2.1.01,6]dodecane-2,4-diol	present	LOTUS
(1S,2S,4R,5R,6R)-5-[(1R)-1-hydroxyethyl]-1-isocyano-3,7-dioxatricyclo[4.1.0.02,4]heptan-5-ol	present	LOTUS
(1S,4S,5S,9R)-1,8-dimethyl-4-propan-2-ylspiro[4.5]dec-7-en-9-ol	present	LOTUS
(2'S,5aS,6R,9aS)-1,5a,6,7,8,9a-Hexahydro-6-(1-methylethyl)-1-oxospiro(2-benzoxepin-9(3H),2'-oxirane)-4-carboxylic acid	present	LOTUS

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichoderma koningii has left across the world's sequence archives.

At a glance

DNA specimens77

Marker genes2

GenBank sequences10

eDNA detections102

Countries25

The DNA barcodea real sequence read deposited for this species

ITSMH862585.1 ↗530 bpNetherlands

ACGT

ATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCC …

Trichoderma koningii strain CBS 457.96 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Trichoderma koningii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈36 688 559 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Trichoderma koningii0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.2% BUSCO

08Occurrence & distribution

Record type155 records

Wild obs. + sensor24

Museum / vouchered127

Cultivated / captive2

Other2

Range

Area of Occupancy AOO404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 20

21 georeferenced · 3 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 6≤10 km 10>10 km 6

22 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence127

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	10
ILLSlocation not on record	10
DPIlocation not on record	9
Uppsala, SE	7
UFPElocation not on record	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	2
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	2
Philadelphia, US	1
Bronx, US	1
WU-MYClocation not on record	1
Catholic University of Pekinglocation not on record	1

11 institutions · 46 of 127 vouchered records shown · 56 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA102 detections

Where the DNA of Trichoderma koningii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found102

Studies independent surveys5

Countries25

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 102 detections have coordinates

Open the map25 countries0

PalearcticNearcticAfrotropicNeotropicIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 6.90–25.2

Seasonal swing summer↔winter16.4 °C

Max temp (day)18.7 °C 10.3–29.6

Min temp (night)9.70 °C 2.90–20.2

Precipitation73.8 mm/mo 32.9–180

Air humidity62.0 % 50.2–64.2

Moisture balance-3.30 mm/mo -91.4–148

Vapour deficit713 Pa 386–1,267

Wind speed2.60 m/s 1.50–5.10

Cloud cover41.0 % 25.2–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)