Trichocladus ellipticus

Eckl. & Zeyh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Hamamelidaceae/Trichocladus

At a glance

Occurrence records277

Data sources11

Biological traits22

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Trichocladus ellipticus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF277 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Trichocladus ellipticus is a species in the genus Trichocladus, in the family Hamamelidaceae. It is also called white witch-hazel.Coates-Palgrave, M. 2002. Keith Coates-Palgrave "Trees of Southern Africa", edn 3, imp. 4. Random House Struik (Pty), Ltd, Cape Town. . pp 243, 244

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height6.67 m

⚠ sources differ — GIFT: 6.67 m · TRY: 9 m

Plant height max12 m

Plant height min1.5 m

Seed mass19.8 mg

Seed mass max19.8 mg

Seed mass min19.8 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 300 m

Elevation min5 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry4

Leaf n14.21 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.07 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichocladus ellipticus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences7

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG846175.1 ↗672 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGCGAACACGTAACAATGCTATGGGGGCGAGGGGAGGCATGCCCCTTCTCAACCCCAGAGTCGGG …

Trichocladus ellipticus voucher Chen et al. 2012053 (PE) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trichocladus ellipticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Morawetz, W. & M. R. A. Samuel. 1989. Karyological patterns in the Hamamelidae. Syst. Assoc. Special Vol. 40(2): 131–135.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type277 records

Wild obs. + sensor70

Museum / vouchered207

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 40≤1 km 8≤10 km 3

51 georeferenced · 19 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence207

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TAFORI-LSRClocation not on record	19
Adam Mickiewicz University in Poznańlocation not on record	16
Saint Louis, US	16
Kew, GB	16
WAGlocation not on record	8
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	8
Clocation not on record	7
Addis Ababa, ET	5
Uppsala, SE	5
Stockholm, SE	4
Haramaya Universitylocation not on record	4
EAlocation not on record	4
Pretoria, ZA	3
Plocation not on record	3
Claremont, US	3
MeiseBGlocation not on record	3
FTlocation not on record	3
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	2
Bronx, US	2
Frankfurt am Main	2
Glocation not on record	2
Helsinki, FI	2
Berlin, DE	2
Moscow State Universitylocation not on record	1
Museo Entomologico de Leonlocation not on record	1
University of Stellenboschlocation not on record	1
MHUlocation not on record	1
University of Oxfordlocation not on record	1
University of Johannesburglocation not on record	1
Njala Universitylocation not on record	1
CJBGlocation not on record	1
Mlocation not on record	1
LGlocation not on record	1
GENTlocation not on record	1
National Natural History Collectionslocation not on record	1
LDlocation not on record	1
Elocation not on record	1
Brookings, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

39 institutions · 155 of 207 vouchered records shown · 52 without an institution code

09Environmental DNA2 detections

Where the DNA of Trichocladus ellipticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 14.2–14.2

Seasonal swing summer↔winter9.30 °C

Max temp (day)19.7 °C

Min temp (night)8.90 °C

Precipitation55.1 mm/mo

Air humidity59.3 %

Moisture balance-35.7 mm/mo

Vapour deficit656 Pa

Wind speed3.10 m/s

Cloud cover15.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)