Trichocentrum cosymbephorum

(C.Morren) R.Jiménez & Carnevali · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Trichocentrum

At a glance

Occurrence records42

Data sources4

Biological traits7

DNA specimens0

eDNA detections2

Sources4 archives

Databases and archives Trichocentrum cosymbephorum's data was compiled from.

GBIFGlobal Biodiversity Information Facility42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF42 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Woodinessnon-woody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichocentrum cosymbephorum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ565349.1 ↗593 bp

ACGT

TTCCTTCATGGGGGAGGGGGCACGACTGAGGATGGATGAACAACAAACCGGGGCAGCATCGCGCCAAGGGAAGATTGGAATGCACGAGCC …

Trichocentrum cosymbephorum voucher Carnevali 6243 AMO, CICY internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type42 records

Wild obs. + sensor35

Museum / vouchered7

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 15≤1 km 3≤10 km 4>10 km 4

26 georeferenced · 9 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	3
Durango, MX	2
San Luis Potosí, MX	1
Ciudad de México, MX	1

4 institutions · 7 of 7 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Trichocentrum cosymbephorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)