Trichocalyx obovatus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Trichocalyx

At a glance

Occurrence records18

Data sources6

Biological traits3

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Trichocalyx obovatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF18 records

DNA & barcodingNCBIsequences

01Narrative

Trichocalyx obovatus is a species of plant in the family Acanthaceae. It is endemic to Yemen. Its natural habitats are subtropical or tropical dry forests and subtropical or tropical dry shrubland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formshrub

Habitat & environment1

Climatedesert or dry shrubland

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichocalyx obovatus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKY632589.1 ↗560 bp

ACGT

CGTGCTTAACGCCGGCGCGTGCGCCGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACCGAAAGCGAAGCGCCCTCCCCC …

Trichocalyx obovatus voucher Thulin and Gifri 8503 (UPS) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type18 records

Wild obs. + sensor4

Museum / vouchered14

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	5
Stockholm, SE	2
Kew, GB	2
MAlocation not on record	1
Frankfurt am Main	1
Uppsala, SE	1
Edinburgh, GB	1

7 institutions · 13 of 14 vouchered records shown · 1 without an institution code