Trichobilharzia regenti

Horak, Kolarova & Dvorak, 1998 · species

image placeholder — illustration coming later

Animalia/Platyhelminthes/Trematoda/Diplostomida/Schistosomatidae/Trichobilharzia

At a glance

Occurrence records10

Data sources10

Biological traits0

DNA specimens37

eDNA detections26

Sources10 archives

Databases and archives Trichobilharzia regenti's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 records

Environmental DNA1 datasets · 3 countries26 detections

DNA & barcodingBOLD37 specimens

Genome at a glanceGoaT · NCBI1.3 Gbp

01Narrative

Trichobilharzia regenti is a neuropathogenic parasitic flatworm of birds which also causes cercarial dermatitis in humans. The species was originally described in 1998 in the Czech Republic and afterwards it was detected also in other European countries, e.g. Denmark, Germany, France, Iceland, Poland, Switzerland, or Russia, and even in Iran. For its unique neurotropic behaviour in vertebrate hosts, the host-parasite interactions are extensively studied in terms of molecular biology, biochemistry and immunology.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichobilharzia regenti has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes11

eDNA detections26

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

87Tmostly conserved

159Gmostly conserved

192Tvariable

252Cmostly conserved

327Tvariable

408Tmostly conserved

468Tmostly conserved

558Avariable

567Amostly conserved

592Amostly conserved

607Gvariable

625Tmostly conserved

TCTTTACCTGTTTTGGCGGCTGGGATAACTATGTTGTTGTTTGATCGGAAATTTGGTACTGCTTTTTTTGAGCCTTGTGGGGGGGGTGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes7

BIN1

Most divergent pair1.4%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trichobilharzia frankisame genus8.7%Trichobilharzia szidatisame genus9.0%Trichobilharzia physellaesame genus10.8%Trichobilharzia querquedulaesame genus11.7%Trichobilharzia stagnicolaesame genus12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_009680 ↗ · 12 protein · 22 tRNA · 2 rRNA

COX3CYTBND4LND4ATP6ND2ND1ND3COX1COX2ND6ND5l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Trichobilharzia regenti carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 281 180 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Trichobilharzia regenti1.28 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness17.6% BUSCO

08Occurrence & distribution

Record type10 records

Museum / vouchered10

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	2
Copenhagen, DK	1

2 institutions · 3 of 10 vouchered records shown · 1 without an institution code

09Environmental DNA26 detections

Where the DNA of Trichobilharzia regenti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 1.20–22.0

Seasonal swing summer↔winter21.8 °C

Max temp (day)21.4 °C 2.60–27.6

Min temp (night)10.6 °C -2.80–13.9

Precipitation41.0 mm/mo 5.50–86.0

Air humidity51.2 % 39.8–67.3

Moisture balance-66.1 mm/mo -124–33.8

Vapour deficit1,246 Pa 249–1,940

Wind speed3.50 m/s 2.40–6.80

Cloud cover31.7 % 21.6–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)