Trichilia triacantha

Urb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Meliaceae/Trichilia

At a glance

Occurrence records11

Data sources9

Biological traits6

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Trichilia triacantha's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF11 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Trichilia triacantha, the bariaco, is a species of plant in the Meliaceae family. It is endemic to Puerto Rico. It is threatened by habitat loss. It is a federally listed endangered species of the United States. The bariaco is a shrub or a tree reaching up to 9 meters tall. It has leaves made up of several leathery, spine-toothed leaflets and the flowers are white.USFWS. Determination of Endangered Status for the Plant Trichilia triacantha (Bariaco). Federal Register February 5, 1988. The fruit is a capsule with a red aril.Ventosa-Febles, E. A. (2007). Distribution and habitat characteristics of Trichilia triacantha (Meliaceae) in Puerto Rico. Endanger Species Res 3 267-71. The plant grows in dry forest habitat on limestone substrates, often near intermittent streams. As of 2007 there were 10 populations of the tree containing a total of 109 individuals. 47 of these were found to be fertile. Six of the ten populations were located in the Guánica National Forest. Two of these were composed of single individuals located several kilometers from other members of the species, and so are unlikely to reproduce. This plant has been overharvested because its wood is useful and attractive.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Woodinesswoody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trichilia triacantha has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLN833652.1 ↗720 bp

ACGT

AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTTGTGATTATGCT …

Trichilia triacantha genomic DNA sequence contains 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2, 28S rRNA gene, specimen voucher MWC 25326

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

07Deep time~4.75 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.75 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type11 records

Wild obs. + sensor9

Museum / vouchered2

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 9

9 georeferenced

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	1
LDlocation not on record	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Trichilia triacantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)