Trametopsis cervina

(Schwein.) Tomšovský · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Irpicaceae/Trametopsis

At a glance

Occurrence records1 545

Data sources8

Biological traits0

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Trametopsis cervina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 545 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 545 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceNCBI≈30 Mbp

01Narrative

Het reebruin elfenbankje is een schimmel behorend tot de familie Irpicaceae. Het leeft saprotroof op dood hout van loofbomen en struiken. Het komt voor op vele houtsoorten en zelden op coniferen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trametopsis cervina has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes1

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV920777.1 ↗295 bpUSA · 2022

ACGT

GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCATTAGATTTTTTTCTAATGCAG …

Trametopsis cervina isolate S. D. Russell iNat # 112457215 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceNCBI

The complete instruction manual Trametopsis cervina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈29 819 895 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Trametopsis cervina0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 545 records

Wild obs. + sensor1 412

Museum / vouchered133

Range

Area of Occupancy AOO4 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 522≤1 km 220≤10 km 173>10 km 65

980 georeferenced · 432 without coordinates

Open the mapobservation + sensor1 412

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 20≤1 km 10≤10 km 3>10 km 2

35 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	30
WU-MYClocation not on record	10
Salzburg, AT	8
Kew, GB	7
TENN-Flocation not on record	7
California State University, East Baylocation not on record	6
Université de Montréal Biodiversity Centrelocation not on record	6
Mlocation not on record	5
Görlitz, DE	4
Chicago, US	3
GJOlocation not on record	3
MeiseBGlocation not on record	2
Philadelphia, US	2
San Sebastián, ES	2
Asheville, US	2
Copenhagen, DK	2
WTUlocation not on record	1
Bardejov, SK	1
Bronx, US	1
Mexico City, MX	1
Catholic University of Pekinglocation not on record	1
UAclocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Göteborg, SE	1
Warsaw, PL	1
Karlsruhe, DE	1
Ciudad de México, MX	1
Odawara, JP	1
CABI Bioscience Genetic Resource Collectionlocation not on record	1

29 institutions · 112 of 133 vouchered records shown · 20 without an institution code

09Environmental DNA9 detections

Where the DNA of Trametopsis cervina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

ForestShrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 9.30–12.8

Seasonal swing summer↔winter14.6 °C

Max temp (day)17.2 °C 14.3–19.4

Min temp (night)5.80 °C 4.50–7.80

Precipitation57.6 mm/mo 48.8–113

Air humidity54.2 % 52.4–59.9

Moisture balance-50.7 mm/mo -58.5–43.5

Vapour deficit638 Pa 545–661

Wind speed2.50 m/s 1.70–3.70

Cloud cover36.4 % 34.9–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trametopsis cervina

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 545 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 545 records