Trachurus indicus

Nekrasov, 1966 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Carangidae/Trachurus

At a glance

Occurrence records94

Data sources10

Biological traits6

DNA specimens5

eDNA detections1

Sources10 archives

Databases and archives Trachurus indicus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

OBISOcean Biodiversity Information System53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS94 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD5 specimens

01Narrative

The Arabian scad (Trachurus indicus) is a species of jack mackerel from the family Carangidae which is found in the Western Indian Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length35 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max400 m

Vulnerability30.61

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trachurus indicus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P683 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes2

BIN1

Most divergent pair0.59%

Where individuals differ — all 4 variable positions, in barcode order

6Tmostly conserved

510Gmostly conserved

681Tmostly conserved

683Cmostly conserved

AAAGATATCGGCACCCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACCGCTTTAAGCCTGCTTATTCGGGCAGAACTAAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trachurus lathamisame genus1.5%Trachurus trecaesame genus1.5%Trachurus mediterraneussame genus1.7%Trachurus novaezelandiaesame genus1.8%Trachurus delagoasame genus1.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor20

Museum / vouchered74

Range

Area of Occupancy AOO136 km²

Depth

0–200 m sunlit20

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 38.5 m · max 112.5 m · 20 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 12≤10 km 1>10 km 2

15 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	9
Washington, US	5
CASlocation not on record	4
National Natural History Collectionslocation not on record	4
	3
Istanbul University, Science Faculty, Hydrobiology Museumlocation not on record	2
FishBaselocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1
Frankfurt am Main	1
Chicago, US	1

10 institutions · 31 of 74 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Trachurus indicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)