Torula herbarum

(Pers.) Link · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Torulaceae/Torula

At a glance

Occurrence records2 320

Data sources11

Biological traits0

DNA specimens2

eDNA detections233

Sources11 archives

Databases and archives Torula herbarum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI233 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF2 320 records

Environmental DNA10 datasets · 26 countries233 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Torula herbarum is a darkly-pigmented filamentous fungus in the phylum Ascomycota. It is often included in the unrelated but morphologically similar group of fungi known as sooty molds. It was first described by Persoon in the genus Monilinia based on similarity to the agent of brown rot of stone fruit but later transferred to the genus Torula by Link. Conidia of T. herbarum are dark brown or olivaceous colour and have a distinctive shape and number of cells. T. herbarum produces secondary metabolites with cytotoxic activity towards bacteria and human cancer cells.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition7 compounds

Compounds documented for Torula herbarum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Naphthoquinones4

Pyrrolizidine alkaloids1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(3R)-3,7,9-trimethoxy-3-methyl-1,4-dihydrobenzo[g]isochromene-5,10-dione	present	LOTUS
2-Butenoic acid, 2-methyl-, 7-[[2,3-dihydroxy-2-(1-hydroxyethyl)-3-methyl-1-oxobutoxy]methyl]-2,3,5,7a-tetrahydro-1H-pyrrolizin-1-yl ester	present	NPASS
Dehydroherbarin	present	LOTUS
ent-astropaquinone C	present	LOTUS
Herbarin	present	LOTUS
Herbarone	present	LOTUS
PCXBVCXCFQSVMD-PHFDDMDRSA-N	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Torula herbarum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences7

eDNA detections233

Countries26

The DNA barcodea real sequence read deposited for this species

ITSPV581387.1 ↗234 bpChina · 2022

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGAGAAATGAGGCGAAGGGCGGCCCAACCGCCGCCCGGAGCCGAC …

Torula herbarum voucher SGB 2022,TangChi 230 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type2 320 records

Wild obs. + sensor1 607

Museum / vouchered702

Cultivated / captive3

Other8

Range

Area of Occupancy AOO4 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 104≤1 km 46≤10 km 1 441

1 591 georeferenced · 16 without coordinates

Open the mapobservation + sensor1 607

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 26≤1 km 134≤10 km 204>10 km 68

432 georeferenced · 270 without coordinates

Open the institutions mapphysical evidence702

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	390
Durango, MX	22
Bernard Price Institute for Palaeontological Researchlocation not on record	20
Auckland, NZ	20
Uppsala, SE	19
Universidad Nacional de Colombialocation not on record	8
Kew, GB	8
Laboratorio de Ictiologialocation not on record	7
DPIlocation not on record	7
The University of Hong Konglocation not on record	7
Madison, US	4
Museo Entomologico de Leonlocation not on record	4
PHlocation not on record	4
Chicago, US	4
WU-MYClocation not on record	3
San Sebastián, ES	3
BDBClocation not on record	2
Pullman, US	2
TENN-Flocation not on record	2
Karlsruhe, DE	2
GJOlocation not on record	2
Catholic University of Pekinglocation not on record	2
Brown Universitylocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Museo de La Platalocation not on record	1
Champaign, US	1
IPA/SPlocation not on record	1
Lincoln, US	1
Laramie, US	1
Görlitz, DE	1
Ann Arbor, US	1
Bronx, US	1
Museu Paraense Emílio Goeldilocation not on record	1
SLU Artdatabankenlocation not on record	1
GZUlocation not on record	1
Clemson, US	1

36 institutions · 556 of 702 vouchered records shown · 146 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA233 detections

Where the DNA of Torula herbarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found233

Studies independent surveys10

Countries26

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 233 detections have coordinates

Open the map26 countries0

PalearcticAfrotropicNeotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature13.0 °C 9.00–21.0

pH5.50 3.70–8.30

Conductivity128 µS/cm 20.0–457

Organic carbon3.83 % 0.77–5.90

Water content9.29 % 4.38–45.0

Nitrate-N11.0 mg/kg 0.5–67.0

Phosphorus47.0 mg/kg 3.00–225

Clay18.7 % 2.99–31.9

Sand60.5 % 27.2–93.0

Depth0 m 0–0.2

SoilVertosolKurosolSodosolChromosolsDermosolTenosols

23 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 8.70–24.1

Seasonal swing summer↔winter13.1 °C

Max temp (day)19.4 °C 13.4–28.5

Min temp (night)10.6 °C 3.90–19.1

Precipitation72.5 mm/mo 12.0–152

Air humidity59.0 % 55.8–63.8

Moisture balance-26.8 mm/mo -101–38.9

Vapour deficit698 Pa 456–1,161

Wind speed3.00 m/s 2.00–4.20

Cloud cover37.5 % 16.4–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 229 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Torula herbarum

At a glance

Sources11 archives

Compound class profile2 classes

Documented compounds7 total

At a glance

Record type2 320 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 320 records