Todarodes sagittatus

(Lamarck, 1798) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Ommastrephidae/Todarodes

At a glance

Occurrence records3 315

Data sources10

Biological traits9

DNA specimens16

eDNA detections19

Sources10 archives

Databases and archives Todarodes sagittatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility760 records↗

OBISOcean Biodiversity Information System2 555 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources9 traits

Occurrence & distributionGBIF · OBIS3 315 records

Environmental DNA2 datasets · 5 countries19 detections

DNA & barcodingBOLD16 specimens

01Narrative

dorsal view The European flying squid (Todarodes sagittatus) is a species of squid from the continental slope and oceanic waters of the eastern Atlantic Ocean and the Mediterranean Sea. It is the type species of the genus Todarodes, the type genus of the subfamily Todarodinae of the pelagic squid family Ommastrephidae. It is a species which is targeted by some fisheries, although it is more often a bycatch.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology2

Body length75 cm

Body mass2 200 g

Life cycle & reproduction1

Max. longevity24 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max4 595 m

Depth min20 m

Vulnerability50

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Todarodes sagittatus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections19

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 2 variable positions, in barcode order

466Gmostly conserved

565Gvariable

TACTCTATATTTTATTTTTGGTATCTGGGCAGGACTATTAGGTACTTCATTAAGATTAATGATCCGAACTGAATTAGGTCAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nototodarus gouldisame family12.8%Eucleoteuthis luminosasame family13.2%Illex coindetiisame family13.4%Illex illecebrosussame family13.5%Nototodarus sloaniisame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 315 records

Wild obs. + sensor380

Museum / vouchered390

Other2 545

Origin

Native1

Range

Area of Occupancy AOO6 388 km²

Depth

0–200 m sunlit1 262

200–1000 m twilight1 213

1–4 km midnight5

>4 km abyssal0

median 196.5 m · max 2 665 m · 2 480 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 51≤1 km 34≤10 km 142>10 km 3

230 georeferenced · 150 without coordinates

Open the mapobservation + sensor380

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 2≤1 km 2≤10 km 5>10 km 1

10 georeferenced · 380 without coordinates

Open the institutions mapphysical evidence390

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICATMARlocation not on record	179
Washington, US	36
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	24
Stockholm, SE	15
ICM-CSIClocation not on record	6
Cambridge, US	4
IEO-COMA-CSIClocation not on record	4
UAclocation not on record	3
UM-RSMASlocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	2
DASSHlocation not on record	2
IEOlocation not on record	2
Philadelphia, US	1
NTNU-VMlocation not on record	1
PNHSlocation not on record	1
South Kensington, GB	1
Natural History Museum Rotterdamlocation not on record	1
Texas Cooperative Wildlife Collectionlocation not on record	1
Deutsches Zentrum fuer Marine Biodiversitaetsforschunglocation not on record	1

19 institutions · 286 of 390 vouchered records shown · 3 without an institution code

09Environmental DNA19 detections

Where the DNA of Todarodes sagittatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys2

Countries5

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.20 °C 5.00–21.0

Seasonal swing summer↔winter6.80 °C

Max temp (day)7.20 °C 6.10–22.6

Min temp (night)5.50 °C 4.00–19.4

Precipitation78.3 mm/mo 16.1–158

Air humidity61.3 % 60.4–69.0

Vapour deficit358 Pa 342–965

Cloud cover51.9 % 40.3–66.5

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Todarodes sagittatus

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type3 315 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 315 records