Todarodes pacificus

(Steenstrup, 1880) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Ommastrephidae/Todarodes

At a glance

Occurrence records530

Data sources11

Biological traits7

DNA specimens63

eDNA detections54

Sources11 archives

Databases and archives Todarodes pacificus's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility244 records↗

OBISOcean Biodiversity Information System286 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics63 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Chemical compositionNPASS9 compounds

Occurrence & distributionGBIF · OBIS530 records

Environmental DNA1 datasets · 3 countries54 detections

DNA & barcodingBOLD63 specimens

01Narrative

The Japanese flying squid, Japanese common squid or Pacific flying squid, scientific name Todarodes pacificus, is a squid of the family Ommastrephidae. This animal lives in the northern Pacific Ocean, in the area surrounding Japan, along the entire coast of China up to Russia, then spreading across the Bering Strait east towards the southern coast of Alaska and Canada. They tend to cluster around the central region of Vietnam.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body mass500 g

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max500 m

Depth min0 m

Vulnerability10

03Chemical composition9 compounds

Compounds documented for Todarodes pacificus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Gallotannins3

Gallotannins $ Simple phenolic acids1

Simple phenolic acids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
3,3'-di-O-Methylellagic acid	present	NPASS
3-Methylellagic acid	present	NPASS
3-O-Methylgallic acid	present	NPASS
Ellagic acid	present	NPASS
Gallic acid	present	NPASS
OAENUJPXEOXSNX-UHFFFAOYSA-M	present	NPASS
SQSVUJRWTMIUGY-UHFFFAOYSA-L	present	NPASS
UZCNSBGKABLLCB-UHFFFAOYSA-M	present	NPASS
WDSQQUKUBNMNRX-UHFFFAOYSA-M	present	NPASS

05DNA & barcoding63 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Todarodes pacificus has left across the world's sequence archives.

At a glance

DNA specimens63

BINs3

Marker genes9

eDNA detections54

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

11Tmostly conserved

194Cmostly conserved

485Gmostly conserved

503Gmostly conserved

504Cmostly conserved

524Gmostly conserved

578Amostly conserved

611Tmostly conserved

617Tmostly conserved

GATTAATGATTCGTACCGAATTAGGTCAACCCGGATCTTTATTAAATGATGATCAATTATATAACGTAGTAGTTACTGCTCACGGATTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes13

BINs3

Most divergent pair4.4%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nototodarus sloaniisame family8.9%Nototodarus gouldisame family10.2%Todaropsis eblanaesame family13.6%Ornithoteuthis antillarumsame family13.9%Eucleoteuthis luminosasame family14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_006354 ↗ · 18 protein · 22 tRNA · 2 rRNA

COX3ND3COX1COX2ATP8ATP6ND2ND5ND4ND4LCYTBND6ND1s-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type530 records

Wild obs. + sensor58

Museum / vouchered472

Origin

Native2

Range

Area of Occupancy AOO944 km²

Depth

0–200 m sunlit3

200–1000 m twilight5

1–4 km midnight0

>4 km abyssal0

median 213.2 m · max 379 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 3≤10 km 2

6 georeferenced · 52 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤1 km 23≤10 km 4>10 km 9

36 georeferenced · 436 without coordinates

Open the institutions mapphysical evidence472

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	196
Washington, US	11
CASlocation not on record	7
Museums Victorialocation not on record	7
NSMKlocation not on record	5
Santa Barbara Museum of Natural Historylocation not on record	2
UM-RSMASlocation not on record	2
Texas Cooperative Wildlife Collectionlocation not on record	2

8 institutions · 232 of 472 vouchered records shown · 1 without an institution code

09Environmental DNA54 detections

Where the DNA of Todarodes pacificus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-4.40 °C -4.60–7.70

Seasonal swing summer↔winter41.0 °C

Max temp (day)-1.10 °C -1.10–10.2

Min temp (night)-6.50 °C -7.00–3.00

Precipitation54.0 mm/mo 13.7–83.0

Air humidity65.1 % 55.5–65.1

Moisture balance-1.80 mm/mo -19.2–24.6

Vapour deficit269 Pa 260–468

Wind speed5.60 m/s 3.90–5.60

Cloud cover57.6 % 40.6–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)