Tipula paludosa

Meigen, 1830 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tipulidae/Tipula

At a glance

Occurrence records21 016

Data sources8

Biological traits0

DNA specimens644

eDNA detections1 190

Sources8 archives

Databases and archives Tipula paludosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 016 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 190 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics644 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF21 016 records

Environmental DNA6 datasets · 15 countries1 190 detections

DNA & barcodingBOLD644 specimens

Genome at a glanceGoaT · TreeOfSex2n = 8

01Narrative

La tipule des prairies, communément appelée « cousin » ou « mouche-faucheux », est une espèce d'insectes diptères de la famille des Tipulidae, ressemblant à un grand moustique à très longues pattes. Pris à tort pour un moustique, cet insecte n'est pas un insecte piqueur. Ses larves peuvent engendrer quelques dégâts dans les prairies permanentes et les semis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding644 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tipula paludosa has left across the world's sequence archives.

At a glance

DNA specimens644

BINs3

Marker genes1

eDNA detections1 190

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus547 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

210Gvariable

216Amostly conserved

315Gmostly conserved

633Tmostly conserved

ACTTTATATTTCATTTTTGGGGCTTGAGCTGGTATAGTAGGAACTTCCTTAAGAATTTTAATTCGAGCAGAACTTGGTCATCCTGGGGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes26

BINs3

Most divergent pair4.1%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tipula subcunctanssame genus3.4%Tipula oleraceasame genus5.5%Tipula mediterraneasame genus6.1%Tipula subnodicornissame genus9.9%Tipula sertasame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Tipula paludosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome records8–82n range8median8mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 86×GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Makino, S. (1951). An atlas of the chromosome numbers in Animals. Ames, Iowa, Iowa State College Press. ↗

TreeOfSex · invert — Wolf, E. (1941). "Die Chromosomen in der Spermatogenese einiger Nematoceren." Zeitschrift fur Zellforschung und Mikroskopische Anatomie Abt. B Chromosoma 2(1): 192-246. ↗

08Occurrence & distribution

Record type21 016 records

Wild obs. + sensor20 061

Museum / vouchered903

Other52

Range

Area of Occupancy AOO40 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 8 573≤1 km 5 726≤10 km 4 115>10 km 317

18 731 georeferenced · 1 330 without coordinates

Open the mapobservation + sensor20 061

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 103≤1 km 133≤10 km 35>10 km 7

278 georeferenced · 625 without coordinates

Open the institutions mapphysical evidence903

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	221
Provincia di Livornolocation not on record	97
SLU Artdatabankenlocation not on record	25
BioFokuslocation not on record	20
Tromsø, NO	19
Uniwersytet Łódzkilocation not on record	12
Gothenburg, SE	9
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	9
South Kensington, GB	9
CIBIOlocation not on record	9
NCMGlocation not on record	8
MZLUlocation not on record	6
Natural History Museum, Londonlocation not on record	6
CBDClocation not on record	6
Naturalis Biodiversity Centerlocation not on record	6
Wellcome Sanger Institutelocation not on record	5
Stockholm, SE	3
Rovaniemi, FI	3
Helsinki, FI	2
University of Oslo, Natural History Museumlocation not on record	2
Tilburg, NL	2
Metsähallituslocation not on record	1
DFlocation not on record	1
Regional Museum of Laplandlocation not on record	1
Ugentlocation not on record	1
NHMOlocation not on record	1

26 institutions · 484 of 903 vouchered records shown · 419 without an institution code

09Environmental DNA1 190 detections

Where the DNA of Tipula paludosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 190

Studies independent surveys6

Countries15

Verifiable raw sequence linked577

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 190 detections have coordinates

Open the map15 countries0

GartenGarden and heatland, coastal habitatmixed grass and woodland on bunterTemperate mixed forestRebgelande14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 12.2–16.7

Seasonal swing summer↔winter17.8 °C

Max temp (day)19.6 °C 14.1–21.2

Min temp (night)11.8 °C 9.60–13.7

Precipitation89.5 mm/mo 65.9–115

Air humidity62.1 % 59.8–64.7

Moisture balance1.70 mm/mo -27.3–40.9

Vapour deficit671 Pa 507–741

Wind speed3.60 m/s 2.30–4.80

Cloud cover50.0 % 42.3–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 1 167 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tipula paludosa

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type21 016 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type21 016 records